Gene detail

Detail information of GWHGAAZE033049

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009781542.1	1.02182E-80	PREDICTED: probable leucine-rich repeat receptor-like protein kinase At5g49770 isoform X1 [Nicotiana sylvestris]
COG	YP_144860.1	0.000001	serine/threonine protein kinase
Swissprot	tr\|Q9LT96\|Y5977_ARATH	3E-54	Probable leucine-rich repeat receptor-like protein kinase At5g49770 (Precursor)
trEMBL	tr\|K4B1J8\|K4B1J8_SOLLC	2E-77	Uncharacterized protein {ECO:0000313\|EnsemblPlants:Solyc01g102700.2.1}
TAIR10	AT5G49760.1	8E-56	Leucine-rich repeat protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000089	gene	116390	121496	+
GWHAAZE00000089	mRNA	116390	121496	+
GWHAAZE00000089	exon	116390	116440	+
GWHAAZE00000089	exon	121023	121496	+
GWHAAZE00000089	CDS	116390	116440	+
GWHAAZE00000089	CDS	121023	121496	+

Transcript Sequence
>GWHTAAZE033088 ATGGGCGACACTGACAAGGGTCATGTTACCACTCAAGTCAAAGGGACAATGGGCTACATGGACCCCGAATATTACATGACCCAACAATTAACGGAAAAGAGTGATGTTTACAGTTTTGGAGTTGTACTATTGGAGTTAATAACTGCGAGACCTCCTATACGTCAAGGGAGTTATATTGTAAAAGAGGTGCGGCAATCAATGGACAGAACAAAAGATCTATACAACATTCAAGGAGTTCTCGACCCCGCCATTGGCCAGTTCACAGATCTTAGGGGCTTAGAGAAATTCATTGACATTTCAATGAGGTGTGTTGAAGAGGCCGGCGTCCACAGACCCACAATGAGCGAGGTGGTGAAAGAGATAGAGAATGCCATGGAAATGGCGGGCTTTAATGCAAATGTTGAGTCGGCTTCGACTTCAGCAAGTTATGAAGGGGTAAGTAAGGGATATGAGCATCCTTATAGTAATGAAAGCCTTTTTGTTCATAGTGGTGCTCATCTCCCTTCAAAGGTGGATCCCAAGTGA

Network for GWHGAAZE033049

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	8	119	4.00E-11

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-VIII-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.822
	SRR3591706	second leaf	1.596
	SRR3591707	mature leaf	13.082
	SRR3591708	Shoot apex	1.594
	SRR3591709	Stem	4.492
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.042
	SRR3591712	Green floral bud	0.097
	SRR3591713	Yellow flower	0.074
SRP173429	SRR8316895	Juvenile bud stage	1.863
	SRR8316896	Juvenile bud stage	2.552
	SRR8316897	Juvenile bud stage	0.632
	SRR8316894	Third green stage	1.342
	SRR8316900	Third green stage	0.693
	SRR8316901	Third green stage	0.655
	SRR8316898	Complete white stage	0.411
	SRR8316899	Complete white stage	1.656
	SRR8316903	Complete white stage	0.667
	SRR8316902	Silver flowering stage	0.180
	SRR8316904	Silver flowering stage	0.184
	SRR8316905	Silver flowering stage	0.104
	SRR8316906	Gold flowering stage	0.939
	SRR8316907	Gold flowering stage	0.497
	SRR8316908	Gold flowering stage	0.272
SRP132670	SRR6706286	Control	2.160
	SRR6706287	Light intensity 50%	1.360
	SRR6706288	Light intensity 20%	1.679
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.852
	CNS0095593	Slightly white alabastrum(diploid) 2	1.283
	CNS0095594	Slightly white alabastrum(diploid) 3	3.433
	CNS0095595	Whole white alabastrum(diploid) 2	2.167
	CNS0095596	Whole white alabastrum(diploid) 3	1.177
	CNS0095597	Whole white alabastrum(diploid) 4	1.633
	CNS0095598	Silvery flower (diploied) 1	4.190
	CNS0095599	Silvery flower (diploied) 2	4.584
	CNS0095600	Silvery flower (diploied) 3	1.804
	CNS0095601	Golden flower (diploid) 1	7.237
	CNS0095602	Golden flower (diploid) 2	2.201
	CNS0095603	Golden flower (diploid) 3	3.020
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.696
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.215
	CNS0095606	Slightly white alabastrum(tetraploid) 3	4.766
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.820
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.603
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.490
	CNS0095610	Silvery flower (tetraploid) 1	0.987
	CNS0095611	Silvery flower (tetraploid) 2	1.286
	CNS0095612	Silvery flower (tetraploid) 3	0.419
	CNS0095613	Golden flower (tetraploid) 1	1.062
	CNS0095614	Golden flower (tetraploid) 2	1.058
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.221
	CRR073298	Stem 2	1.292
	CRR073299	Stem 3	2.107
	CRR073300	Leaf 1	0.797
	CRR073301	Leaf 2	1.618
	CRR073302	Leaf 3	1.064
	CRR073303	Juvenile bud 1	1.401
	CRR073304	Juvenile bud 2	0.626
	CRR073305	Juvenile bud 3	1.060
	CRR073306	Third green 1	0.308
	CRR073307	Third green 2	0.183
	CRR073308	Third green 3	0.086
	CRR073309	Second white 1	0.401
	CRR073310	Second white 2	0.744
	CRR073311	Second white 3	0.052
	CRR073312	Silver flowering 1	0.218
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.284
	CRR073315	Gold flowering 1	23.832
	CRR073316	Gold flowering 2	45.357
	CRR073317	Gold flowering 3	21.442
	CRR073318	Tawny withering 1	8.040
	CRR073319	Tawny withering 2	9.291
	CRR073320	Tawny withering 3	5.099