Gene detail

Detail information of GWHGAAZE001746

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP04198.1	2.26687E-23	unnamed protein product [Coffea canephora]
trEMBL	tr\|A0A068U9E3\|A0A068U9E3_COFCA	8E-24	Coffea canephora DH200=94 genomic scaffold, scaffold_12 {ECO:0000313\|EMBL:CDP04198.1}
TAIR10	AT1G65220.1	2E-17	ARM repeat superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000001	gene	59490154	59490568	+
GWHAAZE00000001	mRNA	59490154	59490568	+
GWHAAZE00000001	exon	59490154	59490225	+
GWHAAZE00000001	exon	59490458	59490568	+
GWHAAZE00000001	CDS	59490154	59490225	+
GWHAAZE00000001	CDS	59490458	59490568	+

Transcript Sequence
>GWHTAAZE001750 GGTACGCGGATTAAGACCCGCAAACGGAATATCGCTGCTCCTCTGGACCCTGCAGCATTCTCGGATGCAGTGGAACTTATTGCTAGGAGCATTGAATCTTCAGACCTTAACTTCTCCAGATACGGTGACACCTTTTTTGAGGCAAGTATCTTGGTCTTTCTTGATTCTCTTAAGATGGCTTGA

Network for GWHGAAZE001746

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF08263.13	LRRNT_2	34	77	2.50E-08
PF13516.7	LRR_6	126	142	1.1
PF13516.7	LRR_6	149	165	1.3
PF13855.7	LRR_8	413	473	4.50E-07
PF00069.26	Pkinase	804	1010	3.70E-42

Protein Sequence

>GWHPAAZE017786
MSEEDTDHPPFVPLLVIIFILATGSVVVVGDSLETDREVLLKLKSFLEEQNRVNRGRYAEWKPTESSPCNWTGISCSGGRVTGIDLYKSAISGELFGNFSAISELTHLNLSQNTISGKMPADLGRCLKLKYLNLSHNMIDGEINLTTLHSLEILDLSLNRIRGEIRFSFPGICDSLVVANLSSNHFTGEVGNSLEHCQNLQYVDLSSNSLTGNLWYGFERLRGFVVSENNLGGNISPGIFTENCSLSYLDLSENNFSGEFPKEISNCKSLRVLNGWGNNFTGRIPQELGSISSLQGILLGNNSFSREIPESLLNLSNLVFLDLSRNSFGGDIQEIFGRFTQVKYLLLHSNSYTGGIYSSGILNLPNISRLDLSSNNFSGPLPVEISQMLSLEYLFLAYNQFTGNIPSEYGNLPRLQAIDLSFNKLNGSIPSSLGNLTSLLWLMLANNSLTGQIPPALGNCSSLLWLNLANNQLSGKIPAELTDIGNNPTPTFQSNRENERITVGSGECFAMKRWIPANYPPFSFVYTVLTRKNCRSLWDSLLKGYGVFPVCVPGSSVQTFDISGYVQLSGNQLSGEVPREIGKMRSFGMMHLGVNQFNGTLPKEIGQIALVVFNISQNKFSGEIPMELGSMKCLQNLDLSYNNFSGNFPTSLNNLSDLNKFNISYNPYIAGVVPTTGQLSTFEKWSFLGDPLLHLPSFMENGTNITPGKNENPKRPNKFGTFLLFMAVLMAFLVCGVMTIIVCNMVKSPVNVQGYLLEGTKGPHDFASSSGKSSPWLTDTVKVIRLDKTAFTHADILAATGNFSDERIIGRGGSGTVYRGMLPDGREVAVKKLQREGIEGEREFRAEMEVLSGNGFGWPHPNLVILYGWCLFGSEKLLVYEYMKGGSLEDLVLDRTKLTWRRRIDVAIDVARALVFLHHECDPSIVHRDVKASNVLLDKNGKARVTDFGLARIFEAGGSHVSTIVAGTVGYVAPEYGQTWQATTKGDVYSYGVLALELATGRRAVDGGEECLVEWARRVMGNGRVGFSGSMVPVALLVSGLAEGAEELRELLRIGIRCTAEAPQARPNMKQVLSMLIEISGGSLRDFSYGSSPPPSL

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-Xb-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0005515	molecular_function	protein binding
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	1.281
	SRR3591706	second leaf	8.621
	SRR3591707	mature leaf	1.682
	SRR3591708	Shoot apex	12.026
	SRR3591709	Stem	1.987
	SRR3591710	White floral bud	3.656
	SRR3591711	White flower	33.295
	SRR3591712	Green floral bud	22.241
	SRR3591713	Yellow flower	40.334
SRP173429	SRR8316895	Juvenile bud stage	50.989
	SRR8316896	Juvenile bud stage	69.584
	SRR8316897	Juvenile bud stage	39.459
	SRR8316894	Third green stage	40.264
	SRR8316900	Third green stage	129.799
	SRR8316901	Third green stage	128.428
	SRR8316898	Complete white stage	89.293
	SRR8316899	Complete white stage	195.219
	SRR8316903	Complete white stage	126.987
	SRR8316902	Silver flowering stage	76.641
	SRR8316904	Silver flowering stage	113.997
	SRR8316905	Silver flowering stage	59.003
	SRR8316906	Gold flowering stage	165.144
	SRR8316907	Gold flowering stage	180.940
	SRR8316908	Gold flowering stage	171.508
SRP132670	SRR6706286	Control	235.258
	SRR6706287	Light intensity 50%	249.207
	SRR6706288	Light intensity 20%	276.699
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	48.743
	CNS0095593	Slightly white alabastrum(diploid) 2	47.305
	CNS0095594	Slightly white alabastrum(diploid) 3	40.505
	CNS0095595	Whole white alabastrum(diploid) 2	62.715
	CNS0095596	Whole white alabastrum(diploid) 3	69.102
	CNS0095597	Whole white alabastrum(diploid) 4	76.315
	CNS0095598	Silvery flower (diploied) 1	45.254
	CNS0095599	Silvery flower (diploied) 2	39.834
	CNS0095600	Silvery flower (diploied) 3	204.352
	CNS0095601	Golden flower (diploid) 1	58.026
	CNS0095602	Golden flower (diploid) 2	163.432
	CNS0095603	Golden flower (diploid) 3	156.712
	CNS0095604	Slightly white alabastrum(tetraploid) 1	126.676
	CNS0095605	Slightly white alabastrum(tetraploid) 2	127.649
	CNS0095606	Slightly white alabastrum(tetraploid) 3	176.969
	CNS0095607	Whole white alabastrum(tetraploid) 1	161.472
	CNS0095608	Whole white alabastrum(tetraploid) 2	159.672
	CNS0095609	Whole white alabastrum(tetraploid) 3	224.090
	CNS0095610	Silvery flower (tetraploid) 1	269.251
	CNS0095611	Silvery flower (tetraploid) 2	342.721
	CNS0095612	Silvery flower (tetraploid) 3	278.838
	CNS0095613	Golden flower (tetraploid) 1	151.980
	CNS0095614	Golden flower (tetraploid) 2	228.745
	CNS0095615	Golden flower (tetraploid) 3	325.104
CRA001975	CRR073297	Stem 1	119.841
	CRR073298	Stem 2	108.192
	CRR073299	Stem 3	142.697
	CRR073300	Leaf 1	171.905
	CRR073301	Leaf 2	158.380
	CRR073302	Leaf 3	195.127
	CRR073303	Juvenile bud 1	162.235
	CRR073304	Juvenile bud 2	206.878
	CRR073305	Juvenile bud 3	209.235
	CRR073306	Third green 1	218.612
	CRR073307	Third green 2	198.177
	CRR073308	Third green 3	180.079
	CRR073309	Second white 1	218.043
	CRR073310	Second white 2	189.092
	CRR073311	Second white 3	190.136
	CRR073312	Silver flowering 1	161.605
	CRR073313	Silver flowering 2	146.797
	CRR073314	Silver flowering 3	146.373
	CRR073315	Gold flowering 1	96.565
	CRR073316	Gold flowering 2	112.013
	CRR073317	Gold flowering 3	121.250
	CRR073318	Tawny withering 1	133.204
	CRR073319	Tawny withering 2	80.969
	CRR073320	Tawny withering 3	109.141