Gene detail

Detail information of GWHGAAZE033741

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010673010.1	3.19318E-38	PREDICTED: DNA polymerase I A, chloroplastic/mitochondrial-like isoform X1 [Beta vulgaris subsp. vulgaris]
Swissprot	tr\|F4I6M1\|POLIA_ARATH	9E-32	DNA polymerase I A, chloroplastic/mitochondrial (Precursor)
trEMBL	tr\|A0A061F6W2\|A0A061F6W2_THECC	8E-35	Polymerase gamma 2 isoform 3 {ECO:0000313\|EMBL:EOY12452.1}
TAIR10	AT1G50840.1	2E-19	polymerase gamma 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000130	gene	742792	745074	+
GWHAAZE00000130	mRNA	742792	745074	+
GWHAAZE00000130	exon	742792	742919	+
GWHAAZE00000130	exon	744231	744576	+
GWHAAZE00000130	exon	745054	745074	+
GWHAAZE00000130	CDS	742792	742919	+
GWHAAZE00000130	CDS	744231	744576	+
GWHAAZE00000130	CDS	745054	745074	+

Transcript Sequence
>GWHTAAZE033781 ATGGAAAGTACACGGATGCTGATTGATCAAACCCATCTTGCAGAGGTTGAGAAACTGGCTAAAGCTGAGCAGCAAATTGCTGCTGATAGATTTCGCAACTGGGCATCTAAGTACTGTTCAGATGCCAGATCTCAAGAAATTACACTTCACAACTTTGGTGTTAAAATAAAACCCGAAATCTACACCCTAGATGGTTGGTCCTCGGTTAGAGTTGATGCCTTGAAGATCCTCGCTGGCGACATTTCTAAGGAATTTGATTTTACTGATGATGCTTATCAGTTACCATTAGATGATGACGATGAAAATATGCATGGAACAGTGACGAATGAACAGTCAGAGATGTTTGCTTATGGCACTGCCTTTGCTGCATTTGGAGGGCATTCCAAGGGAATTGAGGCTTGCAATGGTATTGCTGCTTTAATTGGAGTTCTCTTGATAAATTCATTGTTATCCTACTACATCCACCCGTTGCAGGTTCCTGGTGGCCAAACGTAA

Network for GWHGAAZE033741

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02335	polA	DNA replication	map03030
		Base excision repair	map03410
		Nucleotide excision repair	map03420
		Homologous recombination	map03440

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.908
	SRR8316896	Juvenile bud stage	1.027
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.764
	SRR8316900	Third green stage	1.358
	SRR8316901	Third green stage	1.374
	SRR8316898	Complete white stage	0.571
	SRR8316899	Complete white stage	2.024
	SRR8316903	Complete white stage	0.315
	SRR8316902	Silver flowering stage	0.062
	SRR8316904	Silver flowering stage	0.874
	SRR8316905	Silver flowering stage	0.452
	SRR8316906	Gold flowering stage	0.694
	SRR8316907	Gold flowering stage	0.399
	SRR8316908	Gold flowering stage	0.239
SRP132670	SRR6706286	Control	0.975
	SRR6706287	Light intensity 50%	0.679
	SRR6706288	Light intensity 20%	1.302
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.414
	CNS0095593	Slightly white alabastrum(diploid) 2	0.351
	CNS0095594	Slightly white alabastrum(diploid) 3	0.510
	CNS0095595	Whole white alabastrum(diploid) 2	0.358
	CNS0095596	Whole white alabastrum(diploid) 3	0.562
	CNS0095597	Whole white alabastrum(diploid) 4	0.449
	CNS0095598	Silvery flower (diploied) 1	0.123
	CNS0095599	Silvery flower (diploied) 2	2.419
	CNS0095600	Silvery flower (diploied) 3	0.428
	CNS0095601	Golden flower (diploid) 1	0.075
	CNS0095602	Golden flower (diploid) 2	0.934
	CNS0095603	Golden flower (diploid) 3	0.792
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.023
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.006
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	2.318
	CRR073298	Stem 2	0.833
	CRR073299	Stem 3	1.249
	CRR073300	Leaf 1	1.028
	CRR073301	Leaf 2	1.544
	CRR073302	Leaf 3	0.060
	CRR073303	Juvenile bud 1	0.315
	CRR073304	Juvenile bud 2	0.066
	CRR073305	Juvenile bud 3	0.351
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.465
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	1.596
	CRR073314	Silver flowering 3	0.205
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.237
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.862
	CRR073319	Tawny withering 2	0.184
	CRR073320	Tawny withering 3	0.000