Gene detail

Detail information of GWHGAAZE033651

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	ADD31435.1	0	NADH-plastoquinone oxidoreductase subunit 1 protein (chloroplast) [Lonicera japonica]
COG	YP_007095361.1	6E-152	NADH:ubiquinone oxidoreductase subunit 1 (chain H)
Swissprot	tr\|Q332S2\|NU1C_LACSA	0	NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic {ECO:0000255\|HAMAP-Rule:MF_01350}
trEMBL	tr\|D3WBN7\|D3WBN7_LONJA	0	NAD(P)H-quinone oxidoreductase subunit 1, chloroplastic {ECO:0000256\|HAMAP-Rule:MF_01350}
TAIR10	ATCG01100.1	2E-149	NADH dehydrogenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000106	gene	46430	48614	+
GWHAAZE00000106	mRNA	46430	48614	+
GWHAAZE00000106	exon	46430	46982	+
GWHAAZE00000106	exon	48076	48614	+
GWHAAZE00000106	CDS	46430	46982	+
GWHAAZE00000106	CDS	48076	48614	+

Transcript Sequence
>GWHTAAZE033690 ATGATAATTGATACAACAGAAGTACAAGCTATCAATTCTTTTTCGAGATTGGAATCCTTAAAAGAAGTCGATGGGATCATATGGATGCTTGTTCCTATTTTCAGTCTTGTATTAGGAATCACAATAGGTGTACTAGTAATTGTTTGGTTAGAAAGAGAAATATCTGCAGGGATACAACAACGTATTGGACCCGAATACGCCGGTCCTTTTGGAATTCTTCAAGCTCTAGCAGATGGTACAAAATTACTTTTCAAAGAGAATCTTCTGCCATCTCGAGGAGATATTCGTTTATTCAGTATCGGACCATCCATCGCAGTCATATCAATTCTACTAAGTTATTTAGTAATTCCTTTTGGCTATCATCTTGTTCTAGCTGATCTCAGTATCGGTGTTTTTTTATGGATTGCAATTTCAAGTATTGCTCCCATTGGACTTCTTATGTCAGGATATGGATCAAATAATAAATATTCTTTTTTAGGCGGTTTACGAGCTGCTGCTCAATCAATTAGTTATGAAATCCCATTAACTCTATGTGTGTTATCAATATCTCTACTATCTAACAGTTCAAGTACAGTTGATGTAGTTGAAGCCCAATCAAAATATGGTTTTTGGGGATGGAATTTGTGGCGTCAACCTATAGGGTTTATCGTTTTTCTAATTTCTTCCCTAGCCGAGTGTGAGAGATTACCTTTTGATTTACCAGAAGCAGAAGAAGAATTGGTAGCAGGTTATCAAACCGAATATTCAGGTATCAAATTTGGTTTATTTTATGTTGCTTCGTATTTGAATCTCTTAGTTTCTTCATTATTTGTAACAGTTCTTTACTTGGGGGGTTGGAATCTTTCCATTCCGTACATATTAGTTCCTCCGCTTTTTGAAATAAATAAAGAGAGTCGAGTCTTTGGAACAATAATGGGTATCTTTATTACATTAGCTAAGACTTATTTGTTCTTGTTCATTCCTATCATAACAAGGTGGACTTTGCCGAGGTTAAGAATGGACCAACTATTAAATCTCGGGTGGAAATTTCTTTTACCTATTTCTCTAGGTAATCTATTATTAACAACCTCTTCCCAACTTCTTTCACTGTAA

Network for GWHGAAZE033651

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00146.22	NADHdh	34	355	7.20E-111

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K05572	ndhA	Metabolic pathways	map01100
K05572	ndhA	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016020	cellular_component	membrane

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.602
	SRR3591706	second leaf	4.213
	SRR3591707	mature leaf	3.886
	SRR3591708	Shoot apex	2.576
	SRR3591709	Stem	0.304
	SRR3591710	White floral bud	0.387
	SRR3591711	White flower	0.262
	SRR3591712	Green floral bud	0.498
	SRR3591713	Yellow flower	0.602
SRP173429	SRR8316895	Juvenile bud stage	8.161
	SRR8316896	Juvenile bud stage	3.617
	SRR8316897	Juvenile bud stage	12.084
	SRR8316894	Third green stage	14.180
	SRR8316900	Third green stage	1.707
	SRR8316901	Third green stage	1.685
	SRR8316898	Complete white stage	3.662
	SRR8316899	Complete white stage	0.869
	SRR8316903	Complete white stage	2.733
	SRR8316902	Silver flowering stage	4.963
	SRR8316904	Silver flowering stage	4.880
	SRR8316905	Silver flowering stage	4.214
	SRR8316906	Gold flowering stage	1.044
	SRR8316907	Gold flowering stage	0.562
	SRR8316908	Gold flowering stage	0.985
SRP132670	SRR6706286	Control	0.071
	SRR6706287	Light intensity 50%	0.101
	SRR6706288	Light intensity 20%	0.132
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.909
	CNS0095593	Slightly white alabastrum(diploid) 2	3.282
	CNS0095594	Slightly white alabastrum(diploid) 3	3.240
	CNS0095595	Whole white alabastrum(diploid) 2	5.865
	CNS0095596	Whole white alabastrum(diploid) 3	5.001
	CNS0095597	Whole white alabastrum(diploid) 4	4.506
	CNS0095598	Silvery flower (diploied) 1	2.380
	CNS0095599	Silvery flower (diploied) 2	3.195
	CNS0095600	Silvery flower (diploied) 3	2.267
	CNS0095601	Golden flower (diploid) 1	2.731
	CNS0095602	Golden flower (diploid) 2	2.545
	CNS0095603	Golden flower (diploid) 3	3.116
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.039
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.412
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.857
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.482
	CNS0095608	Whole white alabastrum(tetraploid) 2	4.202
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.666
	CNS0095610	Silvery flower (tetraploid) 1	2.519
	CNS0095611	Silvery flower (tetraploid) 2	3.432
	CNS0095612	Silvery flower (tetraploid) 3	2.120
	CNS0095613	Golden flower (tetraploid) 1	2.593
	CNS0095614	Golden flower (tetraploid) 2	2.240
	CNS0095615	Golden flower (tetraploid) 3	2.158
CRA001975	CRR073297	Stem 1	1.941
	CRR073298	Stem 2	1.974
	CRR073299	Stem 3	0.575
	CRR073300	Leaf 1	1.586
	CRR073301	Leaf 2	1.407
	CRR073302	Leaf 3	1.029
	CRR073303	Juvenile bud 1	1.125
	CRR073304	Juvenile bud 2	0.992
	CRR073305	Juvenile bud 3	0.893
	CRR073306	Third green 1	0.972
	CRR073307	Third green 2	0.190
	CRR073308	Third green 3	0.894
	CRR073309	Second white 1	0.564
	CRR073310	Second white 2	2.578
	CRR073311	Second white 3	2.948
	CRR073312	Silver flowering 1	2.150
	CRR073313	Silver flowering 2	0.533
	CRR073314	Silver flowering 3	1.590
	CRR073315	Gold flowering 1	6.070
	CRR073316	Gold flowering 2	8.494
	CRR073317	Gold flowering 3	3.111
	CRR073318	Tawny withering 1	0.695
	CRR073319	Tawny withering 2	1.691
	CRR073320	Tawny withering 3	0.510