Gene detail

Detail information of GWHGAAZE033343

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_006447105.1	2.23337E-66	hypothetical protein CICLE_v10018267mg [Citrus clementina]
COG	YP_289850.1	0.00000005	calcium-binding EF-hand
Swissprot	tr\|Q9SRE6\|CML38_ARATH	2E-42	Calcium-binding protein CML38
trEMBL	tr\|V4U8A2\|V4U8A2_9ROSI	8E-67	Uncharacterized protein {ECO:0000313\|EMBL:ESR60345.1}
TAIR10	AT1G76650.3	2E-31	calmodulin-like 38

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	5128549	5128980	+
GWHAAZE00000094	mRNA	5128549	5128980	+
GWHAAZE00000094	exon	5128549	5128980	+
GWHAAZE00000094	CDS	5128549	5128980	+

Transcript Sequence
>GWHTAAZE033382 ATGGAGCACTACAAACAAGAGCAGCAATACGAGCGCGTGTTTAACCACTTTGATGAAAACAAAGATGGAAAGATATCGCCGCTAGAGCTGCAACGATGCGTGGCGTCCATAGGAGGCGATATATCGTTGGAGGAAGCAGAGGCGGCCATGGAGATGATGGATTCGGACGGAGATGGGATGCTGTGTTTGGAGGACTTTGTGAAGTTGGTAGGAGGAGTTGGGGAGGAAGAGAAGGCAAGTGATCTTAGAGAGGCTTTCAAGATGTATGAGATGGACGGGTCCGGTTGCATCACACCTAAAAGCTTGAAGAGGACGCTTAGCAGATTGGGGGAGTCCAAGACAATGGGGGAATGCGAGTTGATGATTGCTAGGTTTGATCTTAATGGGGATGGGGTCCTTCATTTTGATGAGTTCAGGATTATGATGTCCTGA

Network for GWHGAAZE033343

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	8	70	8.50E-12
PF13499.7	EF-hand_7	80	142	5.80E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	10.751
	SRR3591706	second leaf	1.008
	SRR3591707	mature leaf	1.145
	SRR3591708	Shoot apex	1.119
	SRR3591709	Stem	11.958
	SRR3591710	White floral bud	14.063
	SRR3591711	White flower	32.644
	SRR3591712	Green floral bud	1.233
	SRR3591713	Yellow flower	288.568
SRP173429	SRR8316895	Juvenile bud stage	20.304
	SRR8316896	Juvenile bud stage	14.645
	SRR8316897	Juvenile bud stage	13.000
	SRR8316894	Third green stage	2.426
	SRR8316900	Third green stage	2.292
	SRR8316901	Third green stage	9.632
	SRR8316898	Complete white stage	2.165
	SRR8316899	Complete white stage	10.898
	SRR8316903	Complete white stage	6.634
	SRR8316902	Silver flowering stage	9.670
	SRR8316904	Silver flowering stage	9.885
	SRR8316905	Silver flowering stage	10.989
	SRR8316906	Gold flowering stage	86.084
	SRR8316907	Gold flowering stage	76.924
	SRR8316908	Gold flowering stage	52.406
SRP132670	SRR6706286	Control	1.392
	SRR6706287	Light intensity 50%	3.907
	SRR6706288	Light intensity 20%	1.106
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	13.438
	CNS0095593	Slightly white alabastrum(diploid) 2	31.523
	CNS0095594	Slightly white alabastrum(diploid) 3	22.786
	CNS0095595	Whole white alabastrum(diploid) 2	24.504
	CNS0095596	Whole white alabastrum(diploid) 3	2.250
	CNS0095597	Whole white alabastrum(diploid) 4	13.778
	CNS0095598	Silvery flower (diploied) 1	122.503
	CNS0095599	Silvery flower (diploied) 2	135.798
	CNS0095600	Silvery flower (diploied) 3	110.317
	CNS0095601	Golden flower (diploid) 1	221.125
	CNS0095602	Golden flower (diploid) 2	207.149
	CNS0095603	Golden flower (diploid) 3	206.055
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.081
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.431
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.387
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.427
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.141
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.160
	CNS0095610	Silvery flower (tetraploid) 1	79.358
	CNS0095611	Silvery flower (tetraploid) 2	69.907
	CNS0095612	Silvery flower (tetraploid) 3	365.881
	CNS0095613	Golden flower (tetraploid) 1	674.704
	CNS0095614	Golden flower (tetraploid) 2	267.113
	CNS0095615	Golden flower (tetraploid) 3	249.274
CRA001975	CRR073297	Stem 1	2.664
	CRR073298	Stem 2	5.876
	CRR073299	Stem 3	1.393
	CRR073300	Leaf 1	8.171
	CRR073301	Leaf 2	14.684
	CRR073302	Leaf 3	5.266
	CRR073303	Juvenile bud 1	2.673
	CRR073304	Juvenile bud 2	3.415
	CRR073305	Juvenile bud 3	12.311
	CRR073306	Third green 1	42.702
	CRR073307	Third green 2	41.857
	CRR073308	Third green 3	42.244
	CRR073309	Second white 1	78.032
	CRR073310	Second white 2	123.603
	CRR073311	Second white 3	123.855
	CRR073312	Silver flowering 1	311.675
	CRR073313	Silver flowering 2	262.900
	CRR073314	Silver flowering 3	280.310
	CRR073315	Gold flowering 1	4.477
	CRR073316	Gold flowering 2	2.645
	CRR073317	Gold flowering 3	3.957
	CRR073318	Tawny withering 1	2.181
	CRR073319	Tawny withering 2	24.411
	CRR073320	Tawny withering 3	6.698