Gene detail

Detail information of GWHGAAZE033157

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003553942.1	1.94296E-50	PREDICTED: alpha-dioxygenase 1-like [Glycine max]
Swissprot	tr\|Q9SGH6\|DOX1_ARATH	4E-47	Alpha-dioxygenase 1 (Precursor)
trEMBL	tr\|I1N5V7\|I1N5V7_SOYBN	7E-51	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GLYMA19G01480.1}
TAIR10	AT3G01420.1	9E-41	Peroxidase superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000094	gene	2075289	2076531	+
GWHAAZE00000094	mRNA	2075289	2076531	+
GWHAAZE00000094	exon	2075289	2075581	+
GWHAAZE00000094	exon	2076146	2076295	+
GWHAAZE00000094	exon	2076415	2076531	+
GWHAAZE00000094	five_prime_UTR	2075289	2075461	+
GWHAAZE00000094	CDS	2075462	2075581	+
GWHAAZE00000094	CDS	2076146	2076295	+
GWHAAZE00000094	CDS	2076415	2076531	+

Transcript Sequence
>GWHTAAZE033196 ATAAAAGCCTCATTGGAAGTTTGGATATATCATTTAACATGCAATTGAATATAATTAAATGCAGATTATTCACTCGATTGATAAGTTGGGGATATGGCATCGTTTACCGGTATTCATGGGCTTATTTTACCTTGCAATTCGTCGCCACCTTCACTAGACATACAACTTGTTAAATGTCGATAATACTCCGGCGGGTGATAGATTTAACTCCAATAGATATAATGAAACTGCCGGCAGCGCGCCAAGGAACCTTTTTTGGCAGGAACATTCTTCCTCGTGACAACAATGATAAGGTAATGAGGCCAGATCCTATGGTAGTTGCGACAAAGCTTTTGGCACGTCGAGAACTTATAGACACGGGAAAACAATTCAACGTGATAGCAGTTTCTTGGATACAATTTATGATACATGACTGGATTGACCACTTAGAGGATACTCAGCAGATTGAGCTAATTGCACCCGAAGAAGTTGCAAGTGAATGTCCCCTTAAATCCTTCAAGTTTTATAAGACGAAGGAGGTTCCTACGGTGTATCTGATGGTATTGAAAGTGGGCACTTGA

Network for GWHGAAZE033157

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03098.16	An_peroxidase	24	103	1.10E-10

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K10529	DOX	alpha-Linolenic acid metabolism	map00592

Gene Ontology

GO term	Ontology	Name
GO:0006979	biological_process	response to oxidative stress
GO:0055114	biological_process	oxidation-reduction process
GO:0004601	molecular_function	peroxidase activity
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.085
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	1.233
	SRR3591711	White flower	0.905
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	1.383
SRP173429	SRR8316895	Juvenile bud stage	0.078
	SRR8316896	Juvenile bud stage	0.060
	SRR8316897	Juvenile bud stage	0.559
	SRR8316894	Third green stage	0.086
	SRR8316900	Third green stage	0.192
	SRR8316901	Third green stage	0.020
	SRR8316898	Complete white stage	0.055
	SRR8316899	Complete white stage	0.092
	SRR8316903	Complete white stage	0.436
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.272
	SRR8316905	Silver flowering stage	0.022
	SRR8316906	Gold flowering stage	0.752
	SRR8316907	Gold flowering stage	0.173
	SRR8316908	Gold flowering stage	5.765
SRP132670	SRR6706286	Control	0.024
	SRR6706287	Light intensity 50%	0.109
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.274
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.079
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.414
	CNS0095597	Whole white alabastrum(diploid) 4	0.228
	CNS0095598	Silvery flower (diploied) 1	0.430
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.161
	CNS0095601	Golden flower (diploid) 1	0.444
	CNS0095602	Golden flower (diploid) 2	0.135
	CNS0095603	Golden flower (diploid) 3	0.227
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.325
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.046
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.166
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.046
	CNS0095610	Silvery flower (tetraploid) 1	5.257
	CNS0095611	Silvery flower (tetraploid) 2	2.941
	CNS0095612	Silvery flower (tetraploid) 3	0.684
	CNS0095613	Golden flower (tetraploid) 1	4.592
	CNS0095614	Golden flower (tetraploid) 2	1.264
	CNS0095615	Golden flower (tetraploid) 3	3.042
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.089
	CRR073301	Leaf 2	0.038
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.313
	CRR073304	Juvenile bud 2	0.033
	CRR073305	Juvenile bud 3	0.082
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.071
	CRR073308	Third green 3	0.051
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.201
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.286
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.256
	CRR073316	Gold flowering 2	0.280
	CRR073317	Gold flowering 3	0.188
	CRR073318	Tawny withering 1	0.182
	CRR073319	Tawny withering 2	0.254
	CRR073320	Tawny withering 3	0.000