Gene detail

Detail information of GWHGAAZE033034

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002527781.1	1.1362E-38	conserved hypothetical protein [Ricinus communis]
trEMBL	tr\|B9SP62\|B9SP62_RICCO	4E-39	Putative uncharacterized protein {ECO:0000313\|EMBL:EEF34591.1}
TAIR10	AT1G11880.1	7E-20	transferases, transferring hexosyl groups

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000085	gene	10355	10762	-
GWHAAZE00000085	mRNA	10355	10762	-
GWHAAZE00000085	exon	10355	10762	-
GWHAAZE00000085	CDS	10355	10762	-

Transcript Sequence
>GWHTAAZE033073 ATGACGAGGACCATTCAAAATCCAGTTGGAAAAAATCACACTCGCCTCATTTTCCGATCAGCAATCGCATCAAGACTCCTTGTCATAGCACTAATCATACTCTGGAGGAATCTCCTCAGCCCCTACGACACCTCTGCATCATTAAACCCTAATAATTGCATTTCTTCTTCCTCCTCCAACAATGGCAGCAGCAGCCATGGCATTAACATTCGCTTCCCTCGCATCGCTTCCGCTATTGAAGAGAGCATCGTGTGGGACGGCGTTTATTTCGTCCGAATCGCGGAATGCGGGGGTTACGAATACGAGCAGTCCTACGCCTTCTTGCCATTTCTCCCTATCTCCATTTCTTTCGTCTCCAGAACAGGTTTGTTCCTTGGTTACTCAATTTTGACTGGTTTTGGTTTTTGA

Network for GWHGAAZE033034

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04188.14	Mannosyl_trans2	18	121	1.30E-19

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07542	PIGV	Metabolic pathways	map01100
K07542	PIGV	Glycosylphosphatidylinositol	map00563

Gene Ontology

GO term	Ontology	Name
GO:0006506	biological_process	GPI anchor biosynthetic process
GO:0004584	molecular_function	obsolete dolichyl-phosphate-mannose-glycolipid alpha-mannosyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.305
	SRR3591706	second leaf	0.340
	SRR3591707	mature leaf	0.340
	SRR3591708	Shoot apex	0.595
	SRR3591709	Stem	0.773
	SRR3591710	White floral bud	1.465
	SRR3591711	White flower	0.615
	SRR3591712	Green floral bud	0.998
	SRR3591713	Yellow flower	0.727
SRP173429	SRR8316895	Juvenile bud stage	5.295
	SRR8316896	Juvenile bud stage	6.287
	SRR8316897	Juvenile bud stage	3.702
	SRR8316894	Third green stage	2.404
	SRR8316900	Third green stage	8.098
	SRR8316901	Third green stage	7.963
	SRR8316898	Complete white stage	3.060
	SRR8316899	Complete white stage	5.452
	SRR8316903	Complete white stage	5.783
	SRR8316902	Silver flowering stage	1.540
	SRR8316904	Silver flowering stage	3.272
	SRR8316905	Silver flowering stage	1.668
	SRR8316906	Gold flowering stage	6.484
	SRR8316907	Gold flowering stage	6.815
	SRR8316908	Gold flowering stage	7.460
SRP132670	SRR6706286	Control	10.897
	SRR6706287	Light intensity 50%	11.482
	SRR6706288	Light intensity 20%	11.887
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.380
	CNS0095593	Slightly white alabastrum(diploid) 2	1.484
	CNS0095594	Slightly white alabastrum(diploid) 3	3.157
	CNS0095595	Whole white alabastrum(diploid) 2	2.806
	CNS0095596	Whole white alabastrum(diploid) 3	3.897
	CNS0095597	Whole white alabastrum(diploid) 4	3.808
	CNS0095598	Silvery flower (diploied) 1	2.771
	CNS0095599	Silvery flower (diploied) 2	1.617
	CNS0095600	Silvery flower (diploied) 3	3.563
	CNS0095601	Golden flower (diploid) 1	2.924
	CNS0095602	Golden flower (diploid) 2	3.815
	CNS0095603	Golden flower (diploid) 3	4.426
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.937
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.879
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.036
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.595
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.967
	CNS0095609	Whole white alabastrum(tetraploid) 3	2.206
	CNS0095610	Silvery flower (tetraploid) 1	1.286
	CNS0095611	Silvery flower (tetraploid) 2	1.420
	CNS0095612	Silvery flower (tetraploid) 3	1.329
	CNS0095613	Golden flower (tetraploid) 1	0.409
	CNS0095614	Golden flower (tetraploid) 2	0.414
	CNS0095615	Golden flower (tetraploid) 3	1.680
CRA001975	CRR073297	Stem 1	6.864
	CRR073298	Stem 2	6.380
	CRR073299	Stem 3	2.832
	CRR073300	Leaf 1	9.039
	CRR073301	Leaf 2	8.326
	CRR073302	Leaf 3	3.762
	CRR073303	Juvenile bud 1	3.723
	CRR073304	Juvenile bud 2	4.133
	CRR073305	Juvenile bud 3	6.188
	CRR073306	Third green 1	3.912
	CRR073307	Third green 2	3.557
	CRR073308	Third green 3	1.553
	CRR073309	Second white 1	2.503
	CRR073310	Second white 2	2.426
	CRR073311	Second white 3	2.170
	CRR073312	Silver flowering 1	4.486
	CRR073313	Silver flowering 2	1.307
	CRR073314	Silver flowering 3	1.322
	CRR073315	Gold flowering 1	2.644
	CRR073316	Gold flowering 2	6.230
	CRR073317	Gold flowering 3	1.404
	CRR073318	Tawny withering 1	2.443
	CRR073319	Tawny withering 2	3.019
	CRR073320	Tawny withering 3	3.156