Gene detail

Detail information of GWHGAAZE032782

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007163952.1	6.08961E-92	hypothetical protein PHAVU_L002800g [Phaseolus vulgaris]
COG	YP_003196624.1	9E-12	isopentenyl-diphosphate delta-isomerase
Swissprot	tr\|O48964\|IDI1_CAMAC	2E-89	Isopentenyl-diphosphate Delta-isomerase I
trEMBL	tr\|V7D3U4\|V7D3U4_PHAVU	2E-92	Uncharacterized protein {ECO:0000313\|EMBL:ESW35946.1}
TAIR10	AT3G02780.1	8E-71	isopentenyl pyrophosphate:dimethylallyl pyrophosphate isomerase 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000043	gene	13560	16253	+
GWHAAZE00000043	mRNA	13560	16253	+
GWHAAZE00000043	exon	13560	13676	+
GWHAAZE00000043	exon	14810	14912	+
GWHAAZE00000043	exon	15036	15177	+
GWHAAZE00000043	exon	16040	16253	+
GWHAAZE00000043	CDS	13560	13676	+
GWHAAZE00000043	CDS	14810	14912	+
GWHAAZE00000043	CDS	15036	15177	+
GWHAAZE00000043	CDS	16040	16253	+

Transcript Sequence
>GWHTAAZE032820 ATGTTGCTTCCTCGAAAGATTATTAGTTATTAGAATTTTACTAAGTTCGTAGTTATTAGTATTATCAAGGGGGGAAAGCCAGGTCCAGCCCCTCCAAAAACACTAGGTACTAGTGCTCAACGGTCTGCGACAAAGGTGACTTTCCCTCTGGTGTGGACGAACACGTGCTGTAGTCATCCGTTATACCGAGAGCCAGAACTTATAGAGGAGAATGCCCTTGGTGTTAGGAATGCGGCGCAGAGGAAGCTATGGGACGAACTAGGTATTCCCTCTGAAGATATCCCAGTTGATAACTTCACTTCGTTGGGCCGCATACTATATAAGGCTCCTTCTGATGGCAAGTGGGGAGAGCATGAACGTATTGAATCGAACCCGGATGAAGTAGCAGACATTAGGTATGTGAATAGAGACGAGTTGAAAGAGTTGTTGAGAAAAGCAGACGCAGGCTATGGTGGTCTGAAGCTATCCCCTTGGTTCAGACTAGTTGTGGACAATTTCTTGTTTAAATGGTGGGATCATGTTGAAAGGGACACTCTTCTTGAGGCTGTCGATATGAAAACTATTCACAAGTTGTGA

Network for GWHGAAZE032782

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00293.29	NUDIX	44	145	4.50E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01823	idi, IDI	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Terpenoid backbone biosynthesis	map00900

Gene Ontology

GO term	Ontology	Name
GO:0008299	biological_process	isoprenoid biosynthetic process
GO:0004452	molecular_function	isopentenyl-diphosphate delta-isomerase activity
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	29.539
	SRR3591706	second leaf	37.416
	SRR3591707	mature leaf	6.807
	SRR3591708	Shoot apex	37.812
	SRR3591709	Stem	6.607
	SRR3591710	White floral bud	152.477
	SRR3591711	White flower	70.059
	SRR3591712	Green floral bud	17.432
	SRR3591713	Yellow flower	110.510
SRP173429	SRR8316895	Juvenile bud stage	14.494
	SRR8316896	Juvenile bud stage	12.362
	SRR8316897	Juvenile bud stage	6.025
	SRR8316894	Third green stage	2.989
	SRR8316900	Third green stage	7.864
	SRR8316901	Third green stage	11.155
	SRR8316898	Complete white stage	63.242
	SRR8316899	Complete white stage	16.687
	SRR8316903	Complete white stage	89.706
	SRR8316902	Silver flowering stage	47.254
	SRR8316904	Silver flowering stage	65.863
	SRR8316905	Silver flowering stage	41.218
	SRR8316906	Gold flowering stage	63.980
	SRR8316907	Gold flowering stage	53.789
	SRR8316908	Gold flowering stage	50.747
SRP132670	SRR6706286	Control	11.552
	SRR6706287	Light intensity 50%	11.276
	SRR6706288	Light intensity 20%	7.789
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.458
	CNS0095593	Slightly white alabastrum(diploid) 2	12.211
	CNS0095594	Slightly white alabastrum(diploid) 3	17.501
	CNS0095595	Whole white alabastrum(diploid) 2	15.144
	CNS0095596	Whole white alabastrum(diploid) 3	6.798
	CNS0095597	Whole white alabastrum(diploid) 4	15.626
	CNS0095598	Silvery flower (diploied) 1	26.332
	CNS0095599	Silvery flower (diploied) 2	32.294
	CNS0095600	Silvery flower (diploied) 3	82.080
	CNS0095601	Golden flower (diploid) 1	70.182
	CNS0095602	Golden flower (diploid) 2	93.803
	CNS0095603	Golden flower (diploid) 3	93.980
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.242
	CNS0095605	Slightly white alabastrum(tetraploid) 2	16.378
	CNS0095606	Slightly white alabastrum(tetraploid) 3	23.312
	CNS0095607	Whole white alabastrum(tetraploid) 1	8.164
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.432
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.017
	CNS0095610	Silvery flower (tetraploid) 1	116.631
	CNS0095611	Silvery flower (tetraploid) 2	169.535
	CNS0095612	Silvery flower (tetraploid) 3	265.917
	CNS0095613	Golden flower (tetraploid) 1	206.321
	CNS0095614	Golden flower (tetraploid) 2	184.172
	CNS0095615	Golden flower (tetraploid) 3	312.497
CRA001975	CRR073297	Stem 1	9.530
	CRR073298	Stem 2	11.489
	CRR073299	Stem 3	9.357
	CRR073300	Leaf 1	11.439
	CRR073301	Leaf 2	11.198
	CRR073302	Leaf 3	13.708
	CRR073303	Juvenile bud 1	17.016
	CRR073304	Juvenile bud 2	27.330
	CRR073305	Juvenile bud 3	18.520
	CRR073306	Third green 1	321.974
	CRR073307	Third green 2	213.811
	CRR073308	Third green 3	215.033
	CRR073309	Second white 1	177.200
	CRR073310	Second white 2	197.286
	CRR073311	Second white 3	126.237
	CRR073312	Silver flowering 1	79.943
	CRR073313	Silver flowering 2	59.868
	CRR073314	Silver flowering 3	67.473
	CRR073315	Gold flowering 1	1.426
	CRR073316	Gold flowering 2	4.142
	CRR073317	Gold flowering 3	4.537
	CRR073318	Tawny withering 1	26.295
	CRR073319	Tawny withering 2	27.782
	CRR073320	Tawny withering 3	34.496