Gene detail

Detail information of GWHGAAZE032410

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008222674.1	4.5842E-106	PREDICTED: prolyl 4-hydroxylase subunit alpha-1 isoform X1 [Prunus mume]
COG	YP_005436156.1	1E-31	putative prolyl 4-hydroxylase alpha subunit
Swissprot	tr\|Q9ZW86\|P4H1_ARATH	6E-103	Prolyl 4-hydroxylase 1 (Precursor)
trEMBL	tr\|W9S4D2\|W9S4D2_9ROSA	2E-106	Putative prolyl 4-hydroxylase {ECO:0000313\|EMBL:EXC14239.1}
TAIR10	AT2G43080.1	2E-82	P4H isoform 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000021	gene	1790879	1795076	-
GWHAAZE00000021	mRNA	1790879	1795076	-
GWHAAZE00000021	exon	1790879	1790986	-
GWHAAZE00000021	exon	1792643	1792735	-
GWHAAZE00000021	exon	1794385	1794474	-
GWHAAZE00000021	exon	1794603	1794654	-
GWHAAZE00000021	exon	1794748	1794818	-
GWHAAZE00000021	exon	1794914	1794988	-
GWHAAZE00000021	exon	1795074	1795076	-
GWHAAZE00000021	CDS	1795074	1795076	-
GWHAAZE00000021	CDS	1794914	1794988	-
GWHAAZE00000021	CDS	1794748	1794818	-
GWHAAZE00000021	CDS	1794603	1794654	-
GWHAAZE00000021	CDS	1794385	1794474	-
GWHAAZE00000021	CDS	1792643	1792735	-
GWHAAZE00000021	CDS	1790879	1790986	-

Transcript Sequence
>GWHTAAZE032448 ATGGGAATCAAAAGTGATGTTAGGACTAGCTCTGGTATGTTTTTGAACCATGAAGAGAAAAAGTATCCCATGATACAGGCAATTGAAAAGAGAATTTCTGTCTACTCTCAAGTCCCAGTTGAAAATGGAGAGCTGATACAAGTGTTAAGGTATGAAAAAAATCAGTTTTACCGACCGCATCATGACTACTTCTCTGATACTTTTAACTTGAAGCGTGGTGGACAAAGAGTAGCAACAATGCTTATGTATTTAACTGACAATGTTGAGGGGGGAGAAACCTATTTTCCTGGGGCTGGTTCCGGAGAATGCAGCTGTGGCGGGAAGATGGTTAAAGGGATGTGTGTAAAACCTAATAAAGGCGATGCAGTGCTTTTCTGGAGCATGGGGCTAGATGGACAGTCAGATCCAACTAGCGTACATGGAGGATGTGAAGTTCTAAGTGGAGAAAAATGGTCTGCTACAAAATGGATGAGGCAAAAAGTTACTTCCTAA

Network for GWHGAAZE032410

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13640.7	2OG-FeII_Oxy_3	46	158	7.30E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00472	P4HA	Metabolic pathways	map01100
K00472	P4HA	Arginine and proline metabolism	map00330

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0031418	molecular_function	L-ascorbic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	19.650
	SRR3591706	second leaf	10.860
	SRR3591707	mature leaf	21.339
	SRR3591708	Shoot apex	15.306
	SRR3591709	Stem	30.867
	SRR3591710	White floral bud	31.531
	SRR3591711	White flower	22.775
	SRR3591712	Green floral bud	20.111
	SRR3591713	Yellow flower	19.510
SRP173429	SRR8316895	Juvenile bud stage	12.947
	SRR8316896	Juvenile bud stage	20.974
	SRR8316897	Juvenile bud stage	12.843
	SRR8316894	Third green stage	7.652
	SRR8316900	Third green stage	28.390
	SRR8316901	Third green stage	26.815
	SRR8316898	Complete white stage	12.828
	SRR8316899	Complete white stage	31.821
	SRR8316903	Complete white stage	21.799
	SRR8316902	Silver flowering stage	14.606
	SRR8316904	Silver flowering stage	13.962
	SRR8316905	Silver flowering stage	6.593
	SRR8316906	Gold flowering stage	24.931
	SRR8316907	Gold flowering stage	21.309
	SRR8316908	Gold flowering stage	25.733
SRP132670	SRR6706286	Control	22.279
	SRR6706287	Light intensity 50%	20.412
	SRR6706288	Light intensity 20%	23.537
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.996
	CNS0095593	Slightly white alabastrum(diploid) 2	20.564
	CNS0095594	Slightly white alabastrum(diploid) 3	24.295
	CNS0095595	Whole white alabastrum(diploid) 2	18.900
	CNS0095596	Whole white alabastrum(diploid) 3	17.627
	CNS0095597	Whole white alabastrum(diploid) 4	24.828
	CNS0095598	Silvery flower (diploied) 1	22.326
	CNS0095599	Silvery flower (diploied) 2	19.958
	CNS0095600	Silvery flower (diploied) 3	19.507
	CNS0095601	Golden flower (diploid) 1	24.600
	CNS0095602	Golden flower (diploid) 2	19.091
	CNS0095603	Golden flower (diploid) 3	20.525
	CNS0095604	Slightly white alabastrum(tetraploid) 1	14.947
	CNS0095605	Slightly white alabastrum(tetraploid) 2	14.747
	CNS0095606	Slightly white alabastrum(tetraploid) 3	24.961
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.416
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.720
	CNS0095609	Whole white alabastrum(tetraploid) 3	19.602
	CNS0095610	Silvery flower (tetraploid) 1	22.156
	CNS0095611	Silvery flower (tetraploid) 2	21.361
	CNS0095612	Silvery flower (tetraploid) 3	17.967
	CNS0095613	Golden flower (tetraploid) 1	13.003
	CNS0095614	Golden flower (tetraploid) 2	19.432
	CNS0095615	Golden flower (tetraploid) 3	9.954
CRA001975	CRR073297	Stem 1	13.557
	CRR073298	Stem 2	10.329
	CRR073299	Stem 3	10.256
	CRR073300	Leaf 1	17.493
	CRR073301	Leaf 2	15.425
	CRR073302	Leaf 3	6.403
	CRR073303	Juvenile bud 1	14.121
	CRR073304	Juvenile bud 2	13.501
	CRR073305	Juvenile bud 3	11.664
	CRR073306	Third green 1	5.192
	CRR073307	Third green 2	3.662
	CRR073308	Third green 3	5.580
	CRR073309	Second white 1	1.983
	CRR073310	Second white 2	7.455
	CRR073311	Second white 3	4.982
	CRR073312	Silver flowering 1	3.893
	CRR073313	Silver flowering 2	0.781
	CRR073314	Silver flowering 3	3.939
	CRR073315	Gold flowering 1	4.727
	CRR073316	Gold flowering 2	7.077
	CRR073317	Gold flowering 3	6.395
	CRR073318	Tawny withering 1	11.462
	CRR073319	Tawny withering 2	17.796
	CRR073320	Tawny withering 3	20.803