Gene detail

Detail information of GWHGAAZE032171

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007013873.1	2.58623E-86	Calcium-binding EF-hand family protein [Theobroma cacao]
Swissprot	tr\|Q9S744\|CML9_ARATH	4E-10	Calmodulin-like protein 9
trEMBL	tr\|A0A061GQP8\|A0A061GQP8_THECC	1E-86	Calcium-binding EF-hand family protein {ECO:0000313\|EMBL:EOY31492.1}
TAIR10	AT3G18430.2	4E-59	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	72011810	72013868	+
GWHAAZE00000009	mRNA	72011810	72013868	+
GWHAAZE00000009	exon	72011810	72011879	+
GWHAAZE00000009	exon	72012406	72012530	+
GWHAAZE00000009	exon	72013486	72013582	+
GWHAAZE00000009	exon	72013693	72013868	+
GWHAAZE00000009	CDS	72011810	72011879	+
GWHAAZE00000009	CDS	72012406	72012530	+
GWHAAZE00000009	CDS	72013486	72013582	+
GWHAAZE00000009	CDS	72013693	72013868	+

Transcript Sequence
>GWHTAAZE032209 ATGGGAAATACCTCGTCTATGCTCACTCAATACGACATCGAAGAAGTCCAAGAGCACTGCAATAACACCTTTTCGCAGCAGGAAATAGTTTCTCTGTATCAGAGGTTCTGTCAGCTCGATCGCAATGGTGGTGGCTTCGTCTCTGCTGAAGAGTTTCTCTCCGTGCCTGAATTCGCTGTCAATCCTCTCTCCCAGAGATTGTTGAGGATGCTGGATGGATTGAATTTTAAGGAATTTGTAGCATTCTTATCTTCTTTTAGCTCTCGTGCAACCTTGCAACAAAAAGTGGAATTCATCTTTAAGGTTTATGATGCTGACAACAATGGGAAGGTCACATTCAATGATTTATTGGACATTTTGCGGGACTTGACTGGACAATTTATATCCGAACAACAAAGGGAGGTTGGTATTGATTCTAGTAATTTTGTTTTTGCTCTTCTTTTCTCCTCCACCTGCCAAAAGATTTGA

Network for GWHGAAZE032171

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	32	120	4.50E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K06268	PPP3R, CNB	MAPK signaling pathway	map04010
		Wnt signaling pathway	map04310
		VEGF signaling pathway	map04370
		Calcium signaling pathway	map04020
		cGMP-PKG signaling pathway	map04022
		Oocyte meiosis	map04114
		Cellular senescence	map04218
		C-type lectin receptor signaling pathway	map04625
		Natural killer cell mediated cytotoxicity	map04650
		T cell receptor signaling pathway	map04660
		Th1 and Th2 cell differentiation	map04658
		Th17 cell differentiation	map04659
		B cell receptor signaling pathway	map04662
		Glucagon signaling pathway	map04922
		Oxytocin signaling pathway	map04921
		Renin secretion	map04924
		Glutamatergic synapse	map04724
		Long-term potentiation	map04720
		Axon guidance	map04360
		Osteoclast differentiation	map04380

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	31.716
	SRR3591706	second leaf	22.447
	SRR3591707	mature leaf	13.777
	SRR3591708	Shoot apex	38.566
	SRR3591709	Stem	22.181
	SRR3591710	White floral bud	22.077
	SRR3591711	White flower	25.811
	SRR3591712	Green floral bud	27.045
	SRR3591713	Yellow flower	26.310
SRP173429	SRR8316895	Juvenile bud stage	22.006
	SRR8316896	Juvenile bud stage	31.825
	SRR8316897	Juvenile bud stage	12.809
	SRR8316894	Third green stage	12.046
	SRR8316900	Third green stage	31.263
	SRR8316901	Third green stage	25.161
	SRR8316898	Complete white stage	11.032
	SRR8316899	Complete white stage	32.281
	SRR8316903	Complete white stage	13.868
	SRR8316902	Silver flowering stage	10.504
	SRR8316904	Silver flowering stage	11.802
	SRR8316905	Silver flowering stage	4.810
	SRR8316906	Gold flowering stage	20.217
	SRR8316907	Gold flowering stage	19.084
	SRR8316908	Gold flowering stage	15.784
SRP132670	SRR6706286	Control	24.094
	SRR6706287	Light intensity 50%	20.923
	SRR6706288	Light intensity 20%	23.280
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	16.881
	CNS0095593	Slightly white alabastrum(diploid) 2	16.041
	CNS0095594	Slightly white alabastrum(diploid) 3	18.677
	CNS0095595	Whole white alabastrum(diploid) 2	18.229
	CNS0095596	Whole white alabastrum(diploid) 3	12.976
	CNS0095597	Whole white alabastrum(diploid) 4	12.308
	CNS0095598	Silvery flower (diploied) 1	18.661
	CNS0095599	Silvery flower (diploied) 2	12.114
	CNS0095600	Silvery flower (diploied) 3	14.930
	CNS0095601	Golden flower (diploid) 1	13.976
	CNS0095602	Golden flower (diploid) 2	18.936
	CNS0095603	Golden flower (diploid) 3	14.281
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.294
	CNS0095605	Slightly white alabastrum(tetraploid) 2	15.707
	CNS0095606	Slightly white alabastrum(tetraploid) 3	23.301
	CNS0095607	Whole white alabastrum(tetraploid) 1	11.064
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.798
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.940
	CNS0095610	Silvery flower (tetraploid) 1	13.842
	CNS0095611	Silvery flower (tetraploid) 2	13.116
	CNS0095612	Silvery flower (tetraploid) 3	14.822
	CNS0095613	Golden flower (tetraploid) 1	12.259
	CNS0095614	Golden flower (tetraploid) 2	14.071
	CNS0095615	Golden flower (tetraploid) 3	14.360
CRA001975	CRR073297	Stem 1	27.916
	CRR073298	Stem 2	24.827
	CRR073299	Stem 3	26.838
	CRR073300	Leaf 1	28.371
	CRR073301	Leaf 2	34.920
	CRR073302	Leaf 3	33.877
	CRR073303	Juvenile bud 1	25.801
	CRR073304	Juvenile bud 2	15.506
	CRR073305	Juvenile bud 3	15.109
	CRR073306	Third green 1	10.502
	CRR073307	Third green 2	11.763
	CRR073308	Third green 3	10.520
	CRR073309	Second white 1	9.377
	CRR073310	Second white 2	12.364
	CRR073311	Second white 3	5.389
	CRR073312	Silver flowering 1	7.326
	CRR073313	Silver flowering 2	12.279
	CRR073314	Silver flowering 3	5.964
	CRR073315	Gold flowering 1	22.924
	CRR073316	Gold flowering 2	23.813
	CRR073317	Gold flowering 3	13.984
	CRR073318	Tawny withering 1	27.955
	CRR073319	Tawny withering 2	21.796
	CRR073320	Tawny withering 3	20.408