Gene detail

Detail information of GWHGAAZE031978

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU37070.1	2.3614E-107	hypothetical protein MIMGU_mgv1a015140mg [Erythranthe guttata]
Swissprot	tr\|Q53YF3\|SPC3B_ARATH	6E-96	Signal peptidase complex subunit 3B
trEMBL	tr\|A0A022R9Y3\|A0A022R9Y3_ERYGU	9E-108	Uncharacterized protein {ECO:0000313\|EMBL:EYU37071.1}
TAIR10	AT5G27430.1	9E-76	Signal peptidase subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	68411099	68417994	+
GWHAAZE00000009	mRNA	68411099	68417994	+
GWHAAZE00000009	exon	68411099	68411224	+
GWHAAZE00000009	exon	68412024	68412071	+
GWHAAZE00000009	exon	68413038	68413100	+
GWHAAZE00000009	exon	68415072	68415125	+
GWHAAZE00000009	exon	68417412	68417498	+
GWHAAZE00000009	exon	68417869	68417994	+
GWHAAZE00000009	CDS	68411099	68411224	+
GWHAAZE00000009	CDS	68412024	68412071	+
GWHAAZE00000009	CDS	68413038	68413100	+
GWHAAZE00000009	CDS	68415072	68415125	+
GWHAAZE00000009	CDS	68417412	68417498	+
GWHAAZE00000009	CDS	68417869	68417994	+

Transcript Sequence
>GWHTAAZE032016 ATGCATTCGTTCGGGTACAGAGCAAATGCTTTGCTAACGTTCTCTCTGACGATACTAGCCCTAATGTGTGCTATGGCTTCTTTCACCGATCATCTTAATTCTCCTTCTCCCACCGCTCAAGTCCAGGTTTTGAATATCAATCGGTTCCAGAAGAAAGCAGATGGAGACGACGAGATCAGCTTGACACTGAACATATCAGCAAACTTAGAGTCATTGTTTACTTGGAATACGAAACAGGTTTTTGTGTTTTTAGCAGCTGAGTATGAAACCCCAAAGAATTCCCTGAACCAGGTTTCCTTGTGGGATGGTATCATACCTGCCAAAGAGCATGCAAAATTCTGGATTCATACTAAAAACAAGTACCGTTTCATTGATCAGGGAAACAACCTCCGGGGTAGAGATTTTAACTTGACATTGCATTGGCATGTCATGCCCAAGACCGGCAAGATGTCTGCTGACAAAATAGCCATGACTGGTTTTCGTCTACCGGAGTTGTATAGGTGA

Network for GWHGAAZE031978

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04573.13	SPC22	6	164	5.30E-54

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12948	SPCS3, SPC3	Protein export	map03060

Gene Ontology

GO term	Ontology	Name
GO:0006465	biological_process	signal peptide processing
GO:0005787	cellular_component	signal peptidase complex
GO:0016021	cellular_component	integral component of membrane
GO:0008233	molecular_function	peptidase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	92.273
	SRR3591706	second leaf	44.903
	SRR3591707	mature leaf	30.035
	SRR3591708	Shoot apex	61.112
	SRR3591709	Stem	58.641
	SRR3591710	White floral bud	78.738
	SRR3591711	White flower	75.038
	SRR3591712	Green floral bud	83.757
	SRR3591713	Yellow flower	61.757
SRP173429	SRR8316895	Juvenile bud stage	45.176
	SRR8316896	Juvenile bud stage	58.278
	SRR8316897	Juvenile bud stage	29.268
	SRR8316894	Third green stage	21.981
	SRR8316900	Third green stage	77.111
	SRR8316901	Third green stage	73.850
	SRR8316898	Complete white stage	45.194
	SRR8316899	Complete white stage	75.043
	SRR8316903	Complete white stage	67.546
	SRR8316902	Silver flowering stage	32.286
	SRR8316904	Silver flowering stage	44.333
	SRR8316905	Silver flowering stage	25.173
	SRR8316906	Gold flowering stage	55.300
	SRR8316907	Gold flowering stage	61.480
	SRR8316908	Gold flowering stage	64.319
SRP132670	SRR6706286	Control	17.375
	SRR6706287	Light intensity 50%	21.497
	SRR6706288	Light intensity 20%	20.703
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	82.017
	CNS0095593	Slightly white alabastrum(diploid) 2	86.388
	CNS0095594	Slightly white alabastrum(diploid) 3	78.241
	CNS0095595	Whole white alabastrum(diploid) 2	77.133
	CNS0095596	Whole white alabastrum(diploid) 3	95.077
	CNS0095597	Whole white alabastrum(diploid) 4	77.321
	CNS0095598	Silvery flower (diploied) 1	97.923
	CNS0095599	Silvery flower (diploied) 2	62.890
	CNS0095600	Silvery flower (diploied) 3	73.974
	CNS0095601	Golden flower (diploid) 1	47.534
	CNS0095602	Golden flower (diploid) 2	70.262
	CNS0095603	Golden flower (diploid) 3	67.620
	CNS0095604	Slightly white alabastrum(tetraploid) 1	75.520
	CNS0095605	Slightly white alabastrum(tetraploid) 2	68.202
	CNS0095606	Slightly white alabastrum(tetraploid) 3	74.032
	CNS0095607	Whole white alabastrum(tetraploid) 1	72.671
	CNS0095608	Whole white alabastrum(tetraploid) 2	66.313
	CNS0095609	Whole white alabastrum(tetraploid) 3	73.700
	CNS0095610	Silvery flower (tetraploid) 1	79.986
	CNS0095611	Silvery flower (tetraploid) 2	60.626
	CNS0095612	Silvery flower (tetraploid) 3	50.660
	CNS0095613	Golden flower (tetraploid) 1	41.248
	CNS0095614	Golden flower (tetraploid) 2	51.477
	CNS0095615	Golden flower (tetraploid) 3	36.878
CRA001975	CRR073297	Stem 1	29.840
	CRR073298	Stem 2	28.595
	CRR073299	Stem 3	25.857
	CRR073300	Leaf 1	41.580
	CRR073301	Leaf 2	32.657
	CRR073302	Leaf 3	46.394
	CRR073303	Juvenile bud 1	38.151
	CRR073304	Juvenile bud 2	50.600
	CRR073305	Juvenile bud 3	17.708
	CRR073306	Third green 1	19.692
	CRR073307	Third green 2	38.693
	CRR073308	Third green 3	24.059
	CRR073309	Second white 1	25.937
	CRR073310	Second white 2	18.456
	CRR073311	Second white 3	13.793
	CRR073312	Silver flowering 1	19.253
	CRR073313	Silver flowering 2	17.994
	CRR073314	Silver flowering 3	20.603
	CRR073315	Gold flowering 1	10.202
	CRR073316	Gold flowering 2	14.341
	CRR073317	Gold flowering 3	13.951
	CRR073318	Tawny withering 1	23.004
	CRR073319	Tawny withering 2	26.250
	CRR073320	Tawny withering 3	34.962