Gene detail

Detail information of GWHGAAZE031711

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007052481.1	9.72353E-73	Polyamine oxidase 1 isoform 2 [Theobroma cacao]
COG	YP_003122961.1	0.000005	amine oxidase
Swissprot	tr\|Q9FNA2\|PAO1_ARATH	1E-63	Polyamine oxidase 1
trEMBL	tr\|A0A061E2Z7\|A0A061E2Z7_THECC	4E-73	Polyamine oxidase 1 isoform 2 {ECO:0000313\|EMBL:EOX96638.1}
TAIR10	AT5G13700.1	2E-53	polyamine oxidase 1

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	63906360	63909306	+
GWHAAZE00000009	mRNA	63906360	63909306	+
GWHAAZE00000009	exon	63906360	63906370	+
GWHAAZE00000009	exon	63906458	63906519	+
GWHAAZE00000009	exon	63906725	63906879	+
GWHAAZE00000009	exon	63909142	63909306	+
GWHAAZE00000009	CDS	63906360	63906370	+
GWHAAZE00000009	CDS	63906458	63906519	+
GWHAAZE00000009	CDS	63906725	63906879	+
GWHAAZE00000009	CDS	63909142	63909306	+

Transcript Sequence
>GWHTAAZE031749 ATGAATGACATTTCTCCTAAAACACCAATAGAGTTGGCCATTGACTTCATTCTCCATGACTTCGAAATGGCAGAAGTTGAACCAATATCGACTTATGTGGATTTTGGGGAAAGAGAATTTTTAGTTGCTGATGAAAGAGGTTACGAATATTTGCTACATAAAATGGCTGAAACTTTTCTTTTTACCTCGGATGGTGAAATTATGGACAGTCGTCTAAAACTCAACAAGGTTGTTCGGGAATTAAAGCACTCGAGAAACGGGGTTTCGGTAACAACAGAGGATGGTTGTGTTTATGAAGCAAATTACGTGATTTTGTCCGTTAGCATTGGCGTGCTTCAAAGCGACCTCATTTCCTTCCGACCCCCGTTGCCCGTACGTTTCCTCCTCTTCTAA

Network for GWHGAAZE031711

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01593.25	Amino_oxidase	32	125	2.60E-15

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13366	MPAO, PAO1	Metabolic pathways	map01100
		Arginine and proline metabolism	map00330
		beta-Alanine metabolism	map00410

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.285
	SRR3591706	second leaf	1.050
	SRR3591707	mature leaf	2.408
	SRR3591708	Shoot apex	3.087
	SRR3591709	Stem	4.519
	SRR3591710	White floral bud	10.121
	SRR3591711	White flower	5.231
	SRR3591712	Green floral bud	21.607
	SRR3591713	Yellow flower	4.976
SRP173429	SRR8316895	Juvenile bud stage	3.820
	SRR8316896	Juvenile bud stage	22.167
	SRR8316897	Juvenile bud stage	8.848
	SRR8316894	Third green stage	8.404
	SRR8316900	Third green stage	16.427
	SRR8316901	Third green stage	15.257
	SRR8316898	Complete white stage	4.549
	SRR8316899	Complete white stage	8.299
	SRR8316903	Complete white stage	7.339
	SRR8316902	Silver flowering stage	6.578
	SRR8316904	Silver flowering stage	8.582
	SRR8316905	Silver flowering stage	2.111
	SRR8316906	Gold flowering stage	5.199
	SRR8316907	Gold flowering stage	13.400
	SRR8316908	Gold flowering stage	4.549
SRP132670	SRR6706286	Control	15.009
	SRR6706287	Light intensity 50%	11.415
	SRR6706288	Light intensity 20%	14.571
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.067
	CNS0095593	Slightly white alabastrum(diploid) 2	3.555
	CNS0095594	Slightly white alabastrum(diploid) 3	10.682
	CNS0095595	Whole white alabastrum(diploid) 2	7.354
	CNS0095596	Whole white alabastrum(diploid) 3	7.057
	CNS0095597	Whole white alabastrum(diploid) 4	16.519
	CNS0095598	Silvery flower (diploied) 1	3.423
	CNS0095599	Silvery flower (diploied) 2	7.702
	CNS0095600	Silvery flower (diploied) 3	20.618
	CNS0095601	Golden flower (diploid) 1	1.250
	CNS0095602	Golden flower (diploid) 2	10.158
	CNS0095603	Golden flower (diploid) 3	12.634
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.129
	CNS0095605	Slightly white alabastrum(tetraploid) 2	6.580
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.431
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.783
	CNS0095608	Whole white alabastrum(tetraploid) 2	17.580
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.271
	CNS0095610	Silvery flower (tetraploid) 1	11.271
	CNS0095611	Silvery flower (tetraploid) 2	8.969
	CNS0095612	Silvery flower (tetraploid) 3	13.438
	CNS0095613	Golden flower (tetraploid) 1	19.613
	CNS0095614	Golden flower (tetraploid) 2	8.866
	CNS0095615	Golden flower (tetraploid) 3	3.764
CRA001975	CRR073297	Stem 1	5.736
	CRR073298	Stem 2	9.386
	CRR073299	Stem 3	5.805
	CRR073300	Leaf 1	3.964
	CRR073301	Leaf 2	3.399
	CRR073302	Leaf 3	5.154
	CRR073303	Juvenile bud 1	5.029
	CRR073304	Juvenile bud 2	4.525
	CRR073305	Juvenile bud 3	2.811
	CRR073306	Third green 1	11.705
	CRR073307	Third green 2	11.930
	CRR073308	Third green 3	10.191
	CRR073309	Second white 1	13.381
	CRR073310	Second white 2	14.002
	CRR073311	Second white 3	24.939
	CRR073312	Silver flowering 1	37.352
	CRR073313	Silver flowering 2	31.169
	CRR073314	Silver flowering 3	28.505
	CRR073315	Gold flowering 1	3.437
	CRR073316	Gold flowering 2	12.396
	CRR073317	Gold flowering 3	4.765
	CRR073318	Tawny withering 1	7.739
	CRR073319	Tawny withering 2	13.939
	CRR073320	Tawny withering 3	5.810