Gene detail

Detail information of GWHGAAZE031541

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002529981.1	9.675E-113	NAC domain-containing protein, putative [Ricinus communis]
Swissprot	tr\|Q84WP6\|NAC43_ARATH	2E-107	NAC domain-containing protein 43
trEMBL	tr\|B9SVG2\|B9SVG2_RICCO	4E-113	NAC domain-containing protein, putative {ECO:0000313\|EMBL:EEF32424.1}
TAIR10	AT2G46770.1	1E-87	NAC (No Apical Meristem) domain transcriptional regulator superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	60696644	60698007	-
GWHAAZE00000009	mRNA	60696644	60698007	-
GWHAAZE00000009	exon	60696644	60697021	-
GWHAAZE00000009	exon	60697482	60697744	-
GWHAAZE00000009	exon	60697836	60698007	-
GWHAAZE00000009	CDS	60697836	60698007	-
GWHAAZE00000009	CDS	60697482	60697744	-
GWHAAZE00000009	CDS	60696644	60697021	-

Transcript Sequence
>GWHTAAZE031577 ATGAGTATATCCGTAAACGGAGAATCGAAAGTACCTCCTGGCTTCAGATTTCATCCAACAGAAGAAGAACTCTTGCAGTACTACTTGCGGAAGAAAGTTTCTTACAAGGAAATCGACTTGGACGTTATCAAAGACGTCGATCTCAATAGGCTTGAACCATGGGATATTCAAGAGATGTGTAAGATAGGATCAACGCCCCAAAATGATTGGTACTTTTTCAGTCACAAAGACAAGAAGTACCCGACTAGTACGCGCACAAACCGTGCCACTGCTGCTGGATTTTGGAAGGCCACTGGTCGCGATAAGGTGATCCACACCAACGGTAGACGCATTGGGATGAGGAAGACTCTCGTGTTCTACAAAGGTCGTGCCCCTAATGGTCACAAGTCCGATTGGATCATGCACGAATACCGACTACTCGTTGATATCACTAATGTACACTGTGCCACGGGAGAGATGGTACAAGAAGAGGGATGGGTGGTGTGCCGTATATTCAAGAAGAAAAATCACTACAAAAAAACATTTGATAATAGCCCCAACATTAGTGCCTCTTCGTCTATGATCACTTGTGACGCTGTAACAACCGAAAGGCTAATGAACGATTCAAGTTATAATGACGAAGGTACGTTGGAGCAAATTCTTCATCAACATATGGGAAGACCATGCAAGGAAGAAGGCGATGAATCAAAGGACGATGAACTTGCTGATCAATTTTTTAACACAAATAATATTAATATTATCAATGATGACGATGCTGATGGTTTTGTTAATGATCCCATGATGGCTTTGGATGATCACGATAATGATCTCCAA

Network for GWHGAAZE031541

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	12	139	1.70E-36

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.151
	SRR3591706	second leaf	0.645
	SRR3591707	mature leaf	0.173
	SRR3591708	Shoot apex	0.829
	SRR3591709	Stem	0.640
	SRR3591710	White floral bud	0.217
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.313
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	4.487
	SRR8316896	Juvenile bud stage	2.728
	SRR8316897	Juvenile bud stage	1.068
	SRR8316894	Third green stage	1.068
	SRR8316900	Third green stage	0.132
	SRR8316901	Third green stage	0.219
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.004
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.259
	SRR6706287	Light intensity 50%	0.566
	SRR6706288	Light intensity 20%	0.047
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.455
	CNS0095593	Slightly white alabastrum(diploid) 2	0.194
	CNS0095594	Slightly white alabastrum(diploid) 3	2.150
	CNS0095595	Whole white alabastrum(diploid) 2	0.265
	CNS0095596	Whole white alabastrum(diploid) 3	0.051
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.420
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.221
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.807
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.088
	CNS0095612	Silvery flower (tetraploid) 3	0.569
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	10.817
	CRR073298	Stem 2	6.374
	CRR073299	Stem 3	8.444
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.050
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.132
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.070
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.086
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.136
	CRR073317	Gold flowering 3	0.074
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.240
	CRR073320	Tawny withering 3	0.000