Gene detail

Detail information of GWHGAAZE031503

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002535115.1	1.22369E-58	heat shock protein, putative [Ricinus communis]
COG	YP_003956340.1	4E-33	chaperone protein HtpG
Swissprot	tr\|P36183\|ENPL_HORVU	4E-35	Endoplasmin homolog (Precursor)
trEMBL	tr\|B9TA46\|B9TA46_RICCO	5E-59	Heat shock protein, putative {ECO:0000313\|EMBL:EEF27267.1} (Fragment)
TAIR10	AT2G04030.1	1E-47	Chaperone protein htpG family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	59866007	59866690	+
GWHAAZE00000009	mRNA	59866007	59866690	+
GWHAAZE00000009	exon	59866007	59866048	+
GWHAAZE00000009	exon	59866188	59866545	+
GWHAAZE00000009	exon	59866659	59866690	+
GWHAAZE00000009	CDS	59866007	59866048	+
GWHAAZE00000009	CDS	59866188	59866545	+
GWHAAZE00000009	CDS	59866659	59866690	+

Transcript Sequence
>GWHTAAZE031539 ATGGCTCCAGTGCTTAGCAGAAGTGTCACCGCCATATCTTCTGGAAAAGAGAGAGAAGAGTGGTGGTCCGCTGTCGCCGTCGCTGAGAAAGAAGCTCCTGAATTTTCAGGCGAGAAGCACGAGTACCAAGCGGAGGTCACTCGTCTATTGGATTTGATAGTTCATAGTCTTTATAACAACAAGGATATTTTTCTGAGGAAGCTTGTAAGTAATGCAAGTGATGCTCTTGATAAGTTGAGATTTTTAAGCGTGACTGAGCCTTCTTTACTTGGAGATGCTGGTGACCTAGAAATCTGTATCAAGCCTGATCCGGACAATGGAACCATTATTATCAGAGATACTGGTATTGGAATGACCAAACAGGAGCTTATAGACTGTCTTGGAACTATTGCTCAGAGTGGTGGTGGTGTCCACGAAGAGCAAAAGCAATGA

Network for GWHGAAZE031503

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02518.27	HATPase_c	61	127	6.20E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K09487	HSP90B, TRA1	Protein processing in endoplasmic reticulum	map04141
		PI3K-Akt signaling pathway	map04151
		IL-17 signaling pathway	map04657
		Estrogen signaling pathway	map04915
		Thyroid hormone synthesis	map04918
		Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.470
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.101
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.077
	SRR8316897	Juvenile bud stage	0.191
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.012
	SRR8316898	Complete white stage	0.033
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.071
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.046
	SRR8316907	Gold flowering stage	0.325
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.058
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.022
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.065
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.000
	CNS0095598	Silvery flower (diploied) 1	0.062
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.125
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.182
	CNS0095603	Golden flower (diploid) 3	0.347
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.030
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.017
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.160
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.545
	CNS0095610	Silvery flower (tetraploid) 1	0.263
	CNS0095611	Silvery flower (tetraploid) 2	0.118
	CNS0095612	Silvery flower (tetraploid) 3	0.240
	CNS0095613	Golden flower (tetraploid) 1	0.227
	CNS0095614	Golden flower (tetraploid) 2	0.142
	CNS0095615	Golden flower (tetraploid) 3	0.158
CRA001975	CRR073297	Stem 1	0.162
	CRR073298	Stem 2	0.093
	CRR073299	Stem 3	0.050
	CRR073300	Leaf 1	0.352
	CRR073301	Leaf 2	0.148
	CRR073302	Leaf 3	0.375
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.041
	CRR073305	Juvenile bud 3	0.115
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.112
	CRR073309	Second white 1	0.601
	CRR073310	Second white 2	0.706
	CRR073311	Second white 3	0.021
	CRR073312	Silver flowering 1	0.050
	CRR073313	Silver flowering 2	0.124
	CRR073314	Silver flowering 3	0.337
	CRR073315	Gold flowering 1	0.210
	CRR073316	Gold flowering 2	0.379
	CRR073317	Gold flowering 3	0.154
	CRR073318	Tawny withering 1	0.039
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.150