Gene detail

Detail information of GWHGAAZE031474

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011023246.1	8.5064E-28	PREDICTED: F-box/kelch-repeat protein At3g61590-like [Populus euphratica]
Swissprot	tr\|Q9M310\|FBK77_ARATH	3E-12	F-box/kelch-repeat protein At3g61590
trEMBL	tr\|B9GQF5\|B9GQF5_POPTR	4E-28	Uncharacterized protein {ECO:0000313\|EMBL:ERP64418.1}
TAIR10	AT3G61590.2	1E-10	Galactose oxidase/kelch repeat superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	59405434	59407645	-
GWHAAZE00000009	mRNA	59405434	59407645	-
GWHAAZE00000009	exon	59407444	59407645	-
GWHAAZE00000009	exon	59405752	59405795	-
GWHAAZE00000009	exon	59405434	59405669	-
GWHAAZE00000009	five_prime_UTR	59407444	59407645	-
GWHAAZE00000009	five_prime_UTR	59405752	59405795	-
GWHAAZE00000009	five_prime_UTR	59405644	59405669	-
GWHAAZE00000009	CDS	59405434	59405643	-

Transcript Sequence
>GWHTAAZE031510 CCCCCCGACCCATCTATTCTCGAGTTCCCCTTCACTGTTTACAAACATAACATCTACACCCCAATCCCATTTCCTATTTTCCACTTGTATGTTGTTCACAAAAAACTCTCCCAATACTATCTTTTCACCATTTCACGCCAATTTCTCAACACCCATTTGGCCATAAAAGGAGAGGAGGGTTTTTTCTTTATTTGATTCACAGGTGATATGAACTAAATTGGTTGATCACTAGTTTTCCTCTTGCAGGTTTACACTCGGCTCTTCTCTTCTTCATGGAAGGGGAATCATCGTGGGTCAGTAATTGCCTTGAAGATTTTTCAAGAAATACTGGTGAGTTTGATTCATTTTCGGACTTTACCGATGAAACCCATAAAGAAGTTACATCGGTTTCCGTGGAATTGATCTTGCCCGACGATTTGTTAGAGCGAATATTAGCCTATCTCCCTGTGGCAAGCATCTTTAGGGTCGGTTGTGTGTGTAAA

Network for GWHGAAZE031474

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00646.34	F-box	45	70	4.20E-06

Protein Sequence

Gene family

Gene family	subfamily
Ubiquitin Family	F-box

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	9.212
	SRR3591706	second leaf	3.198
	SRR3591707	mature leaf	4.118
	SRR3591708	Shoot apex	10.749
	SRR3591709	Stem	16.340
	SRR3591710	White floral bud	11.847
	SRR3591711	White flower	11.470
	SRR3591712	Green floral bud	8.804
	SRR3591713	Yellow flower	5.709
SRP173429	SRR8316895	Juvenile bud stage	5.122
	SRR8316896	Juvenile bud stage	7.309
	SRR8316897	Juvenile bud stage	4.202
	SRR8316894	Third green stage	2.908
	SRR8316900	Third green stage	8.469
	SRR8316901	Third green stage	8.236
	SRR8316898	Complete white stage	2.832
	SRR8316899	Complete white stage	12.568
	SRR8316903	Complete white stage	5.781
	SRR8316902	Silver flowering stage	1.346
	SRR8316904	Silver flowering stage	3.859
	SRR8316905	Silver flowering stage	1.587
	SRR8316906	Gold flowering stage	3.689
	SRR8316907	Gold flowering stage	5.310
	SRR8316908	Gold flowering stage	4.124
SRP132670	SRR6706286	Control	1.072
	SRR6706287	Light intensity 50%	1.481
	SRR6706288	Light intensity 20%	1.636
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.002
	CNS0095593	Slightly white alabastrum(diploid) 2	2.137
	CNS0095594	Slightly white alabastrum(diploid) 3	3.515
	CNS0095595	Whole white alabastrum(diploid) 2	7.416
	CNS0095596	Whole white alabastrum(diploid) 3	7.480
	CNS0095597	Whole white alabastrum(diploid) 4	8.027
	CNS0095598	Silvery flower (diploied) 1	5.594
	CNS0095599	Silvery flower (diploied) 2	2.775
	CNS0095600	Silvery flower (diploied) 3	4.709
	CNS0095601	Golden flower (diploid) 1	3.801
	CNS0095602	Golden flower (diploid) 2	6.423
	CNS0095603	Golden flower (diploid) 3	4.231
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.392
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.341
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.645
	CNS0095607	Whole white alabastrum(tetraploid) 1	4.994
	CNS0095608	Whole white alabastrum(tetraploid) 2	6.947
	CNS0095609	Whole white alabastrum(tetraploid) 3	9.683
	CNS0095610	Silvery flower (tetraploid) 1	3.621
	CNS0095611	Silvery flower (tetraploid) 2	5.445
	CNS0095612	Silvery flower (tetraploid) 3	3.034
	CNS0095613	Golden flower (tetraploid) 1	1.100
	CNS0095614	Golden flower (tetraploid) 2	3.265
	CNS0095615	Golden flower (tetraploid) 3	3.065
CRA001975	CRR073297	Stem 1	2.611
	CRR073298	Stem 2	3.639
	CRR073299	Stem 3	1.361
	CRR073300	Leaf 1	2.119
	CRR073301	Leaf 2	1.727
	CRR073302	Leaf 3	2.385
	CRR073303	Juvenile bud 1	0.830
	CRR073304	Juvenile bud 2	1.892
	CRR073305	Juvenile bud 3	0.820
	CRR073306	Third green 1	0.279
	CRR073307	Third green 2	0.426
	CRR073308	Third green 3	0.283
	CRR073309	Second white 1	0.277
	CRR073310	Second white 2	0.490
	CRR073311	Second white 3	0.542
	CRR073312	Silver flowering 1	0.690
	CRR073313	Silver flowering 2	1.155
	CRR073314	Silver flowering 3	0.417
	CRR073315	Gold flowering 1	1.068
	CRR073316	Gold flowering 2	1.103
	CRR073317	Gold flowering 3	0.248
	CRR073318	Tawny withering 1	4.892
	CRR073319	Tawny withering 2	1.924
	CRR073320	Tawny withering 3	3.783