Gene detail

Detail information of GWHGAAZE031404

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008238919.1	1.6647E-37	PREDICTED: cytochrome P450 86A8 [Prunus mume]
Swissprot	tr\|O23066\|C86A2_ARATH	1E-37	Cytochrome P450 86A2
trEMBL	tr\|M5WWC9\|M5WWC9_PRUPE	2E-37	Uncharacterized protein {ECO:0000313\|EMBL:EMJ11095.1}
TAIR10	AT4G00360.1	2E-32	cytochrome P450, family 86, subfamily A, polypeptide 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	58446931	58447324	-
GWHAAZE00000009	mRNA	58446931	58447324	-
GWHAAZE00000009	exon	58446931	58447190	-
GWHAAZE00000009	exon	58447255	58447324	-
GWHAAZE00000009	CDS	58447255	58447324	-
GWHAAZE00000009	CDS	58446931	58447190	-

Transcript Sequence
>GWHTAAZE031440 ATGTGGCGGCACGTACCAGACATGCATTTGCACAATTCCCTTCTTGGCCAGAAAGCAAGGCCTTGTGACTGTCCCACTTGGCAGGGTGTGTTCCACGATTTGCTTGGGCAAGGGATCTTCAATTCCGATGGTGACACATGGCTTTTCCAGAGGAACACAGCTGCCCTCGAGTTTACGACTAGGACCCTATGCCAAGCCATGGCTCGTTGGGTGAGCCGAGCCATTAAGCTTCGATTCTGCCCAATTTTAGAGTCAGTTCAGAATTCAGCCAAGCCAGTTGACTTACAAGATCCTTGCTTCGGCTTACTTTCGACAACATTTGTGACTTAG

Network for GWHGAAZE031404

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K15398	CYP86A4S	Metabolic pathways	map01100
K15398	CYP86A4S	Cutin, suberine and wax biosynthesis	map00073

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0005506	molecular_function	iron ion binding
GO:0016705	molecular_function	oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen
GO:0020037	molecular_function	heme binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.729
	SRR3591706	second leaf	1.520
	SRR3591707	mature leaf	1.169
	SRR3591708	Shoot apex	2.105
	SRR3591709	Stem	0.311
	SRR3591710	White floral bud	0.076
	SRR3591711	White flower	0.527
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.397
SRP173429	SRR8316895	Juvenile bud stage	1.035
	SRR8316896	Juvenile bud stage	1.166
	SRR8316897	Juvenile bud stage	1.138
	SRR8316894	Third green stage	0.239
	SRR8316900	Third green stage	0.884
	SRR8316901	Third green stage	0.784
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	1.386
	SRR8316903	Complete white stage	0.236
	SRR8316902	Silver flowering stage	0.272
	SRR8316904	Silver flowering stage	1.015
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.181
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.475
SRP132670	SRR6706286	Control	0.234
	SRR6706287	Light intensity 50%	0.370
	SRR6706288	Light intensity 20%	0.240
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.372
	CNS0095593	Slightly white alabastrum(diploid) 2	0.167
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.801
	CNS0095596	Whole white alabastrum(diploid) 3	0.021
	CNS0095597	Whole white alabastrum(diploid) 4	0.636
	CNS0095598	Silvery flower (diploied) 1	0.244
	CNS0095599	Silvery flower (diploied) 2	0.940
	CNS0095600	Silvery flower (diploied) 3	0.440
	CNS0095601	Golden flower (diploid) 1	0.293
	CNS0095602	Golden flower (diploid) 2	0.140
	CNS0095603	Golden flower (diploid) 3	0.656
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.104
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.744
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.371
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.296
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.465
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.913
	CNS0095610	Silvery flower (tetraploid) 1	0.718
	CNS0095611	Silvery flower (tetraploid) 2	0.060
	CNS0095612	Silvery flower (tetraploid) 3	0.075
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.657
	CNS0095615	Golden flower (tetraploid) 3	0.197
CRA001975	CRR073297	Stem 1	1.128
	CRR073298	Stem 2	1.293
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.665
	CRR073301	Leaf 2	0.477
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.120
	CRR073307	Third green 2	0.193
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.535
	CRR073310	Second white 2	0.064
	CRR073311	Second white 3	0.341
	CRR073312	Silver flowering 1	0.085
	CRR073313	Silver flowering 2	0.298
	CRR073314	Silver flowering 3	0.263
	CRR073315	Gold flowering 1	0.876
	CRR073316	Gold flowering 2	1.696
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.197
	CRR073319	Tawny withering 2	0.400
	CRR073320	Tawny withering 3	0.000