Gene detail

Detail information of GWHGAAZE031377

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_011084411.1	1.04625E-92	PREDICTED: pre-mRNA cleavage factor Im 25 kDa subunit 2-like [Sesamum indicum]
Swissprot	tr\|Q8GXS3\|CFIS2_ARATH	2E-85	Pre-mRNA cleavage factor Im 25 kDa subunit 2 {ECO:0000303\|PubMed:18479511}
trEMBL	tr\|M0U215\|M0U215_MUSAM	6E-96	Uncharacterized protein {ECO:0000313\|EnsemblPlants:GSMUA_Achr9P20560_001}
TAIR10	AT4G25550.1	5E-68	Cleavage/polyadenylation specificity factor, 25kDa subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	58099830	58102919	+
GWHAAZE00000009	mRNA	58099830	58102919	+
GWHAAZE00000009	exon	58099830	58099948	+
GWHAAZE00000009	exon	58100651	58100696	+
GWHAAZE00000009	exon	58101635	58101728	+
GWHAAZE00000009	exon	58101994	58102067	+
GWHAAZE00000009	exon	58102776	58102919	+
GWHAAZE00000009	CDS	58099830	58099948	+
GWHAAZE00000009	CDS	58100651	58100696	+
GWHAAZE00000009	CDS	58101635	58101728	+
GWHAAZE00000009	CDS	58101994	58102067	+
GWHAAZE00000009	CDS	58102776	58102919	+

Transcript Sequence
>GWHTAAZE031413 ATGGTGATGGCGCCGGTGGTGAACACGTATCCTCTATCCAGCTATACCTTCGGTACCAAAGAACCCAAGATGGAGAAAGACACTTCTGTTGCAGATCGTCTCGCTCGTATGAAAACCAACTACATGAAAGAAGGGATGAGGACTAGTGTTGAAGCCATCCTACTGGTCCAAGAGCACAACCATCCCCACATTCTACTTCTGCAAATTGGTAACACCTTCTGTAAACTTCCCGGTGGCCGTTTGAAGCCTGGTGAAAATGAAATTGAAGGCTTGAAAAGGAAATTGTCTAGCAAACTTGCTGCTAATTCGCCTTCTCTCCAACCTAACTGGCAGGAGTGCAAGAAGCTTTACCTTGTTTACTTGTCTGAAAGAGAGTACTTTGCTGTACCCAAAAATCTCAAACTGCTGGCTGTTCCCCTATTTGAGCTCTATGATAATGTTCAGGTGCAACATCAATTTTTCACTAACTCTTTCTAA

Network for GWHGAAZE031377

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13869.7	NUDIX_2	6	108	4.60E-36
PF13869.7	NUDIX_2	111	148	2.00E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14397	NUDT21, CPSF5, CFIM25	mRNA surveillance pathway	map03015

Gene Ontology

GO term	Ontology	Name
GO:0006378	biological_process	mRNA polyadenylation
GO:0005849	cellular_component	mRNA cleavage factor complex
GO:0003729	molecular_function	mRNA binding
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	114.883
	SRR3591706	second leaf	67.971
	SRR3591707	mature leaf	58.220
	SRR3591708	Shoot apex	125.044
	SRR3591709	Stem	73.400
	SRR3591710	White floral bud	112.888
	SRR3591711	White flower	138.925
	SRR3591712	Green floral bud	102.954
	SRR3591713	Yellow flower	136.629
SRP173429	SRR8316895	Juvenile bud stage	67.160
	SRR8316896	Juvenile bud stage	83.389
	SRR8316897	Juvenile bud stage	42.513
	SRR8316894	Third green stage	32.577
	SRR8316900	Third green stage	113.207
	SRR8316901	Third green stage	112.811
	SRR8316898	Complete white stage	63.286
	SRR8316899	Complete white stage	146.820
	SRR8316903	Complete white stage	85.365
	SRR8316902	Silver flowering stage	71.092
	SRR8316904	Silver flowering stage	86.214
	SRR8316905	Silver flowering stage	52.479
	SRR8316906	Gold flowering stage	170.342
	SRR8316907	Gold flowering stage	167.636
	SRR8316908	Gold flowering stage	185.206
SRP132670	SRR6706286	Control	98.162
	SRR6706287	Light intensity 50%	103.420
	SRR6706288	Light intensity 20%	121.018
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	62.387
	CNS0095593	Slightly white alabastrum(diploid) 2	62.989
	CNS0095594	Slightly white alabastrum(diploid) 3	58.720
	CNS0095595	Whole white alabastrum(diploid) 2	52.724
	CNS0095596	Whole white alabastrum(diploid) 3	51.798
	CNS0095597	Whole white alabastrum(diploid) 4	43.631
	CNS0095598	Silvery flower (diploied) 1	73.160
	CNS0095599	Silvery flower (diploied) 2	83.597
	CNS0095600	Silvery flower (diploied) 3	163.063
	CNS0095601	Golden flower (diploid) 1	76.441
	CNS0095602	Golden flower (diploid) 2	134.635
	CNS0095603	Golden flower (diploid) 3	140.851
	CNS0095604	Slightly white alabastrum(tetraploid) 1	69.105
	CNS0095605	Slightly white alabastrum(tetraploid) 2	53.898
	CNS0095606	Slightly white alabastrum(tetraploid) 3	128.601
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.654
	CNS0095608	Whole white alabastrum(tetraploid) 2	31.646
	CNS0095609	Whole white alabastrum(tetraploid) 3	115.434
	CNS0095610	Silvery flower (tetraploid) 1	194.573
	CNS0095611	Silvery flower (tetraploid) 2	182.108
	CNS0095612	Silvery flower (tetraploid) 3	249.699
	CNS0095613	Golden flower (tetraploid) 1	150.880
	CNS0095614	Golden flower (tetraploid) 2	185.860
	CNS0095615	Golden flower (tetraploid) 3	198.293
CRA001975	CRR073297	Stem 1	90.891
	CRR073298	Stem 2	90.014
	CRR073299	Stem 3	100.888
	CRR073300	Leaf 1	95.305
	CRR073301	Leaf 2	88.817
	CRR073302	Leaf 3	103.985
	CRR073303	Juvenile bud 1	96.171
	CRR073304	Juvenile bud 2	108.687
	CRR073305	Juvenile bud 3	104.621
	CRR073306	Third green 1	119.983
	CRR073307	Third green 2	103.662
	CRR073308	Third green 3	111.262
	CRR073309	Second white 1	145.528
	CRR073310	Second white 2	142.488
	CRR073311	Second white 3	139.541
	CRR073312	Silver flowering 1	149.309
	CRR073313	Silver flowering 2	128.819
	CRR073314	Silver flowering 3	124.927
	CRR073315	Gold flowering 1	71.437
	CRR073316	Gold flowering 2	74.890
	CRR073317	Gold flowering 3	63.398
	CRR073318	Tawny withering 1	91.184
	CRR073319	Tawny withering 2	66.995
	CRR073320	Tawny withering 3	85.959