Gene detail

Detail information of GWHGAAZE031369

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010255455.1	1.04721E-94	PREDICTED: phosphomannomutase [Nelumbo nucifera]
Swissprot	tr\|Q7XPW5\|PMM_ORYSJ	1E-95	Phosphomannomutase
trEMBL	tr\|U5U6C1\|U5U6C1_CAMSI	7E-94	Phosphomannomutase {ECO:0000256\|RuleBase:RU361118}
TAIR10	AT2G45790.1	9E-71	phosphomannomutase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	57989957	57991435	+
GWHAAZE00000009	mRNA	57989957	57991435	+
GWHAAZE00000009	exon	57989957	57990024	+
GWHAAZE00000009	exon	57990098	57990197	+
GWHAAZE00000009	exon	57990321	57990416	+
GWHAAZE00000009	exon	57990527	57990616	+
GWHAAZE00000009	exon	57990779	57990830	+
GWHAAZE00000009	exon	57991365	57991435	+
GWHAAZE00000009	CDS	57989957	57990024	+
GWHAAZE00000009	CDS	57990098	57990197	+
GWHAAZE00000009	CDS	57990321	57990416	+
GWHAAZE00000009	CDS	57990527	57990616	+
GWHAAZE00000009	CDS	57990779	57990830	+
GWHAAZE00000009	CDS	57991365	57991435	+

Transcript Sequence
>GWHTAAZE031405 ATGATGGTGCAGGAATTTGTTAATTTTACACTTAATTACATTGCTGACTTGGATATCCCAATAAAAAGGGGAACGTTTATCGAGTTCCGGAGTGGGATGATCAATGTATCACCAATCGGGCGAAACTGCAGTCAGGAAGAACGCGAAGAGTTTGAAAAGTATGACAAGGTTCATAATATACGCTCAACAATGGTAACTGCACTCCGTGAGAAGTTTGGTCACCTTAACCTCACATTTTCCATTGGTGGACAAATTAGTTTTGATGTTTTCCCTCATGGCTGGGACAAGACCTATTGCTTGAAGTACCTTGATGATTTTAGTGAAATCCACTTCTTTGGAGACAAGACCTATAAGGGTGGAAATGACTTTGAGATTTTTGAATCGGAGCGAACCATTGGTCACACAGTTTCTAGCCCTGAGGATACAGAAGAGCAGTGCACAAAACTCTTCCTAAGCAAGCAAGTTGGAGGTTCCTGA

Network for GWHGAAZE031369

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03332.14	PMM	3	150	8.20E-80

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K17497	PMM	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Fructose and mannose metabolism	map00051
		Amino sugar and nucleotide sugar metabolism	map00520

Gene Ontology

GO term	Ontology	Name
GO:0009298	biological_process	GDP-mannose biosynthetic process
GO:0005737	cellular_component	cytoplasm
GO:0004615	molecular_function	phosphomannomutase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	115.086
	SRR3591706	second leaf	102.942
	SRR3591707	mature leaf	40.672
	SRR3591708	Shoot apex	95.297
	SRR3591709	Stem	104.129
	SRR3591710	White floral bud	77.019
	SRR3591711	White flower	76.225
	SRR3591712	Green floral bud	86.572
	SRR3591713	Yellow flower	78.118
SRP173429	SRR8316895	Juvenile bud stage	68.295
	SRR8316896	Juvenile bud stage	96.813
	SRR8316897	Juvenile bud stage	49.082
	SRR8316894	Third green stage	40.213
	SRR8316900	Third green stage	136.731
	SRR8316901	Third green stage	122.263
	SRR8316898	Complete white stage	44.807
	SRR8316899	Complete white stage	89.965
	SRR8316903	Complete white stage	62.480
	SRR8316902	Silver flowering stage	50.033
	SRR8316904	Silver flowering stage	67.578
	SRR8316905	Silver flowering stage	30.447
	SRR8316906	Gold flowering stage	101.990
	SRR8316907	Gold flowering stage	97.420
	SRR8316908	Gold flowering stage	109.095
SRP132670	SRR6706286	Control	43.938
	SRR6706287	Light intensity 50%	47.542
	SRR6706288	Light intensity 20%	54.484
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	132.178
	CNS0095593	Slightly white alabastrum(diploid) 2	139.224
	CNS0095594	Slightly white alabastrum(diploid) 3	123.440
	CNS0095595	Whole white alabastrum(diploid) 2	114.100
	CNS0095596	Whole white alabastrum(diploid) 3	114.604
	CNS0095597	Whole white alabastrum(diploid) 4	95.457
	CNS0095598	Silvery flower (diploied) 1	88.501
	CNS0095599	Silvery flower (diploied) 2	86.968
	CNS0095600	Silvery flower (diploied) 3	71.109
	CNS0095601	Golden flower (diploid) 1	74.073
	CNS0095602	Golden flower (diploid) 2	65.728
	CNS0095603	Golden flower (diploid) 3	61.796
	CNS0095604	Slightly white alabastrum(tetraploid) 1	132.448
	CNS0095605	Slightly white alabastrum(tetraploid) 2	126.566
	CNS0095606	Slightly white alabastrum(tetraploid) 3	143.382
	CNS0095607	Whole white alabastrum(tetraploid) 1	85.702
	CNS0095608	Whole white alabastrum(tetraploid) 2	83.059
	CNS0095609	Whole white alabastrum(tetraploid) 3	104.441
	CNS0095610	Silvery flower (tetraploid) 1	84.441
	CNS0095611	Silvery flower (tetraploid) 2	67.924
	CNS0095612	Silvery flower (tetraploid) 3	114.795
	CNS0095613	Golden flower (tetraploid) 1	62.735
	CNS0095614	Golden flower (tetraploid) 2	71.264
	CNS0095615	Golden flower (tetraploid) 3	52.403
CRA001975	CRR073297	Stem 1	75.521
	CRR073298	Stem 2	59.593
	CRR073299	Stem 3	53.766
	CRR073300	Leaf 1	57.366
	CRR073301	Leaf 2	39.887
	CRR073302	Leaf 3	61.503
	CRR073303	Juvenile bud 1	56.518
	CRR073304	Juvenile bud 2	43.576
	CRR073305	Juvenile bud 3	31.566
	CRR073306	Third green 1	51.378
	CRR073307	Third green 2	74.807
	CRR073308	Third green 3	55.117
	CRR073309	Second white 1	58.768
	CRR073310	Second white 2	61.944
	CRR073311	Second white 3	45.157
	CRR073312	Silver flowering 1	36.732
	CRR073313	Silver flowering 2	25.569
	CRR073314	Silver flowering 3	28.654
	CRR073315	Gold flowering 1	28.305
	CRR073316	Gold flowering 2	42.827
	CRR073317	Gold flowering 3	31.571
	CRR073318	Tawny withering 1	35.971
	CRR073319	Tawny withering 2	30.832
	CRR073320	Tawny withering 3	54.148