Gene detail

Detail information of GWHGAAZE031324

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_007052027.1	0	Dihydrodipicolinate synthase isoform 2 [Theobroma cacao]
COG	YP_270348.1	2E-106	dihydrodipicolinate synthase
Swissprot	tr\|Q42948\|DAPA_TOBAC	0	4-hydroxy-tetrahydrodipicolinate synthase, chloroplastic (Precursor)
trEMBL	tr\|A0A061DTV2\|A0A061DTV2_THECC	0	Dihydrodipicolinate synthase isoform 2 {ECO:0000313\|EMBL:EOX96184.1}
TAIR10	AT2G45440.1	3E-150	dihydrodipicolinate synthase

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	57177447	57178689	+
GWHAAZE00000009	mRNA	57177447	57178689	+
GWHAAZE00000009	exon	57177447	57177454	+
GWHAAZE00000009	exon	57177762	57178689	+
GWHAAZE00000009	CDS	57177447	57177454	+
GWHAAZE00000009	CDS	57177762	57178689	+

Transcript Sequence
>GWHTAAZE031358 ATGGAAAGGACTTCCGCTGAGGAAATAAAATCTCTTAGATTGATAACTGCCATCAAAACACCATATCTACCAGACGGCAGATTCGACCTTGAGGCATATGATGCCTTGGTCAACATGCAAATTGAAGGAGGTGCCGAGGCGGTGATTGTTGGCGGAACCACCGGGGAAGGCCAGTTGATGAGCTGGGATGAACACATAATGCTAATCGGCCACACGGTCAACTGTTTTGGCACGTCAATCAAGGTGATCGGAAACACTGGAAGTAACTCCACGAGGGAAGCAATCCATGCCACTGAACAGGGCTTTGCGGTCGGTATGCACGCAGCCCTACATATTAACCCTTACTATGGTAAAACTTCTTTAGAGGGTTTAGTTTCTCATTTTAATAGCGTGCTCCCAATGGGTCCCACCATTATATATAACGTACCGTCCCGAACGGGCCAAGATATTCCACCACGTGTCATTCACACTGTGGCACAAAGTCCTAATCTTGCTGGTGTAAAGGAGTGTTTGGGAAATGATAGGATAGATGAGTATACGTCGAATGGGATTATCGTCTGGAGTGGGAATGACGACGAATGCCATGATTCAAGGTGGGACCACGGTGCATCTGGGGTTATATCTGTTACTAGTAACTTGGTTCCAGGTTTGATGAGGGAACTTATGTTTAGGGGAAAGAACCCGTTGTTGAATATCAAGCTTTTGCCTTTGATCGAGTGGCTCTTTGGAGAGCCAAACCCGATTGGGTTAAACACGGCTCTGGCTCAGCTCGGGGTTGTGAGGCCTGTTTTCCGGCTGCCATATGTACCTCTCCCATTGGCCAAGAGGGTTGAGTTTGTGAATATAGTGAAGGAAATTGGGAGAGAGAATTTTGTGGGAGAGAGAGATGTTCGGGTTCTTGATGATGATGAGTTTACTTTGATTGGCAGGTACTAG

Network for GWHGAAZE031324

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation
CFinderModule0050	GO:0009089 lysine biosynthetic process via diaminopimelate GOslim:biological_process GO:0008840 4-hydroxy-tetrahydrodipicolinate synthase activity GOslim:molecular_function map00261 Monobactam biosynthesis map00300 Lysine biosynthesis map00650 Butanoate metabolism GO:0016620 oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor GOslim:molecular_function map00250 Alanine, aspartate and glutamate metabolism GO:0016829 lyase activity GOslim:molecular_function

Module ID

Function Annotation

CFinderModule0050

GO:0009089 lysine biosynthetic process via diaminopimelate GOslim:biological_process
GO:0008840 4-hydroxy-tetrahydrodipicolinate synthase activity GOslim:molecular_function
map00261 Monobactam biosynthesis
map00300 Lysine biosynthesis
map00650 Butanoate metabolism
GO:0016620 oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor GOslim:molecular_function
map00250 Alanine, aspartate and glutamate metabolism
GO:0016829 lyase activity GOslim:molecular_function

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00701.23	DHDPS	12	285	7.50E-90

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01714	dapA	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Biosynthesis of amino acids	map01230
		Lysine biosynthesis	map00300
		Monobactam biosynthesis	map00261

Gene Ontology

GO term	Ontology	Name
GO:0009089	biological_process	lysine biosynthetic process via diaminopimelate
GO:0016829	molecular_function	lyase activity
GO:0003824	molecular_function	catalytic activity
GO:0008840	molecular_function	4-hydroxy-tetrahydrodipicolinate synthase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	27.582
	SRR3591706	second leaf	29.453
	SRR3591707	mature leaf	27.534
	SRR3591708	Shoot apex	30.693
	SRR3591709	Stem	27.800
	SRR3591710	White floral bud	25.918
	SRR3591711	White flower	25.130
	SRR3591712	Green floral bud	40.802
	SRR3591713	Yellow flower	24.107
SRP173429	SRR8316895	Juvenile bud stage	27.538
	SRR8316896	Juvenile bud stage	38.371
	SRR8316897	Juvenile bud stage	18.364
	SRR8316894	Third green stage	16.060
	SRR8316900	Third green stage	57.928
	SRR8316901	Third green stage	47.036
	SRR8316898	Complete white stage	9.552
	SRR8316899	Complete white stage	42.841
	SRR8316903	Complete white stage	16.782
	SRR8316902	Silver flowering stage	9.168
	SRR8316904	Silver flowering stage	10.423
	SRR8316905	Silver flowering stage	6.635
	SRR8316906	Gold flowering stage	20.895
	SRR8316907	Gold flowering stage	21.582
	SRR8316908	Gold flowering stage	22.768
SRP132670	SRR6706286	Control	50.374
	SRR6706287	Light intensity 50%	49.616
	SRR6706288	Light intensity 20%	49.521
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	39.663
	CNS0095593	Slightly white alabastrum(diploid) 2	34.954
	CNS0095594	Slightly white alabastrum(diploid) 3	34.212
	CNS0095595	Whole white alabastrum(diploid) 2	33.999
	CNS0095596	Whole white alabastrum(diploid) 3	39.769
	CNS0095597	Whole white alabastrum(diploid) 4	27.535
	CNS0095598	Silvery flower (diploied) 1	20.243
	CNS0095599	Silvery flower (diploied) 2	19.238
	CNS0095600	Silvery flower (diploied) 3	30.561
	CNS0095601	Golden flower (diploid) 1	16.857
	CNS0095602	Golden flower (diploid) 2	28.973
	CNS0095603	Golden flower (diploid) 3	26.426
	CNS0095604	Slightly white alabastrum(tetraploid) 1	40.738
	CNS0095605	Slightly white alabastrum(tetraploid) 2	44.875
	CNS0095606	Slightly white alabastrum(tetraploid) 3	42.691
	CNS0095607	Whole white alabastrum(tetraploid) 1	28.731
	CNS0095608	Whole white alabastrum(tetraploid) 2	28.831
	CNS0095609	Whole white alabastrum(tetraploid) 3	49.473
	CNS0095610	Silvery flower (tetraploid) 1	33.981
	CNS0095611	Silvery flower (tetraploid) 2	37.873
	CNS0095612	Silvery flower (tetraploid) 3	24.806
	CNS0095613	Golden flower (tetraploid) 1	24.795
	CNS0095614	Golden flower (tetraploid) 2	35.360
	CNS0095615	Golden flower (tetraploid) 3	29.396
CRA001975	CRR073297	Stem 1	29.145
	CRR073298	Stem 2	29.538
	CRR073299	Stem 3	33.337
	CRR073300	Leaf 1	27.939
	CRR073301	Leaf 2	31.656
	CRR073302	Leaf 3	32.637
	CRR073303	Juvenile bud 1	35.729
	CRR073304	Juvenile bud 2	29.156
	CRR073305	Juvenile bud 3	34.240
	CRR073306	Third green 1	9.508
	CRR073307	Third green 2	9.009
	CRR073308	Third green 3	10.199
	CRR073309	Second white 1	16.262
	CRR073310	Second white 2	11.667
	CRR073311	Second white 3	11.545
	CRR073312	Silver flowering 1	11.856
	CRR073313	Silver flowering 2	13.768
	CRR073314	Silver flowering 3	12.838
	CRR073315	Gold flowering 1	12.355
	CRR073316	Gold flowering 2	11.663
	CRR073317	Gold flowering 3	12.595
	CRR073318	Tawny withering 1	21.096
	CRR073319	Tawny withering 2	15.208
	CRR073320	Tawny withering 3	21.092