Gene detail

Detail information of GWHGAAZE030100

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009631305.1	1.4214E-114	PREDICTED: endoglucanase 24-like [Nicotiana tomentosiformis]
COG	YP_003075304.1	9E-22	glycoside hydrolase family 9 domain-containing protein
Swissprot	tr\|Q69NF5\|GUN23_ORYSJ	2E-98	Endoglucanase 23 (Precursor)
trEMBL	tr\|M0ZU29\|M0ZU29_SOLTU	3E-115	Endoglucanase {ECO:0000256\|RuleBase:RU361166}
TAIR10	AT4G39010.1	1E-71	glycosyl hydrolase 9B18

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	38285343	38285933	+
GWHAAZE00000009	mRNA	38285343	38285933	+
GWHAAZE00000009	exon	38285343	38285933	+
GWHAAZE00000009	CDS	38285343	38285933	+

Transcript Sequence
>GWHTAAZE030134 ATGTACGCGCTCCAATCTTACAAAGCGTCCGCAGATAGTTTCATGTGCACGCTGGTGCCAGACTCATCATCCCTCCACATAGGATACTCCCCCGGAGGCCTAATCTACAAGCCCGGGGGAAGCAACTTACAACACGCGACCACCATAGCCTTCATTTCCCTCGTTTACGCCAATTATTTAGAACGATCCTCACAAACTATAAATTGTGGTACTGTTGGGGTCGGTCCAGCTTTGCTACGTCAAATTGCCAAAAGACAAGTCGATTACATTTTAGGAGATAATCCCAAGGGCATTTCGTATATGGTTGGATACAGTAACTATTTTCCGCAACGCATTCACCACCGTGGATCTTCGCTTCCTTCGATTAAATATCAGCCGCAATTTATCGGATGTAAAGAGGGATCGGTTTATTTTAACTCGTCCAATCCGAACCCTAATGTGTTGGTTGGGGCAGTGGTGGGTGGACCAGGGGAAGACGATGAGTACGAGGATGATCGAGCTGATTTTCGAAAGTCTGAACCAACGACTTATATTAATGCACCGTTTGTAGGTGCACTAGCTTATTTTGTTGCTAATCCAAATCCTAGCTAG

Network for GWHGAAZE030100

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00759.20	Glyco_hydro_9	3	186	6.50E-43

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01179	E3.2.1.4	Metabolic pathways	map01100
		Starch and sucrose metabolism	map00500
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0005975	biological_process	carbohydrate metabolic process
GO:0004553	molecular_function	hydrolase activity, hydrolyzing O-glycosyl compounds
GO:0003824	molecular_function	catalytic activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	8.772
	SRR3591706	second leaf	24.997
	SRR3591707	mature leaf	1.861
	SRR3591708	Shoot apex	30.884
	SRR3591709	Stem	2.155
	SRR3591710	White floral bud	1.200
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	3.003
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	3.654
	SRR8316896	Juvenile bud stage	3.482
	SRR8316897	Juvenile bud stage	1.939
	SRR8316894	Third green stage	2.272
	SRR8316900	Third green stage	4.117
	SRR8316901	Third green stage	3.070
	SRR8316898	Complete white stage	0.120
	SRR8316899	Complete white stage	6.171
	SRR8316903	Complete white stage	0.505
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.064
	SRR8316905	Silver flowering stage	0.063
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.171
SRP132670	SRR6706286	Control	3.217
	SRR6706287	Light intensity 50%	5.273
	SRR6706288	Light intensity 20%	4.969
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	9.346
	CNS0095593	Slightly white alabastrum(diploid) 2	8.965
	CNS0095594	Slightly white alabastrum(diploid) 3	6.579
	CNS0095595	Whole white alabastrum(diploid) 2	4.911
	CNS0095596	Whole white alabastrum(diploid) 3	4.081
	CNS0095597	Whole white alabastrum(diploid) 4	3.580
	CNS0095598	Silvery flower (diploied) 1	1.737
	CNS0095599	Silvery flower (diploied) 2	3.411
	CNS0095600	Silvery flower (diploied) 3	0.837
	CNS0095601	Golden flower (diploid) 1	3.178
	CNS0095602	Golden flower (diploid) 2	1.053
	CNS0095603	Golden flower (diploid) 3	0.904
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.789
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.947
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.594
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.054
	CNS0095608	Whole white alabastrum(tetraploid) 2	1.685
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.928
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.940
	CNS0095612	Silvery flower (tetraploid) 3	0.483
	CNS0095613	Golden flower (tetraploid) 1	0.028
	CNS0095614	Golden flower (tetraploid) 2	0.094
	CNS0095615	Golden flower (tetraploid) 3	0.196
CRA001975	CRR073297	Stem 1	9.762
	CRR073298	Stem 2	8.820
	CRR073299	Stem 3	8.124
	CRR073300	Leaf 1	11.142
	CRR073301	Leaf 2	8.303
	CRR073302	Leaf 3	10.782
	CRR073303	Juvenile bud 1	5.472
	CRR073304	Juvenile bud 2	11.274
	CRR073305	Juvenile bud 3	4.617
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.069
	CRR073308	Third green 3	0.295
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.051
	CRR073316	Gold flowering 2	0.105
	CRR073317	Gold flowering 3	0.472
	CRR073318	Tawny withering 1	7.938
	CRR073319	Tawny withering 2	4.739
	CRR073320	Tawny withering 3	7.469