Gene detail

Detail information of GWHGAAZE029839

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG12610.1	3.602E-144	Soluble inorganic pyrophosphatase 1, chloroplastic -like protein [Gossypium arboreum]
COG	YP_005035472.1	3E-22	putative inorganic pyrophosphatase
Swissprot	tr\|Q9LXC9\|IPYR1_ARATH	3E-134	Soluble inorganic pyrophosphatase 1, chloroplastic (Precursor)
trEMBL	tr\|B9RX33\|B9RX33_RICCO	6E-144	Inorganic pyrophosphatase, putative {ECO:0000313\|EMBL:EEF44062.1}
TAIR10	AT5G09650.1	6E-107	pyrophosphorylase 6

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000009	gene	34111365	34112693	+
GWHAAZE00000009	mRNA	34111365	34112693	+
GWHAAZE00000009	exon	34111365	34111537	+
GWHAAZE00000009	exon	34111655	34111755	+
GWHAAZE00000009	exon	34111847	34112028	+
GWHAAZE00000009	exon	34112200	34112298	+
GWHAAZE00000009	exon	34112601	34112693	+
GWHAAZE00000009	CDS	34111365	34111537	+
GWHAAZE00000009	CDS	34111655	34111755	+
GWHAAZE00000009	CDS	34111847	34112028	+
GWHAAZE00000009	CDS	34112200	34112298	+
GWHAAZE00000009	CDS	34112601	34112693	+

Transcript Sequence
>GWHTAAZE029873 ATGACAATGCAGGTTTCCCCTTGGCATGATGTACCATTGCACCTGGGTGATGGAGTATTCAATTTTATTGTTGAAATCCCAAAAGAATCAAGTGCAAAGATGGAAGTTGCTACTGATGAGCCATTCACTCCCATTAAACAGGATACCAAGAAAGGAAAACTTCGTTACTATCCATACAATATCAATTGGAACTATGGGTTGCTACCTCAAACATGGGAAGATCCCTCATTAGCGAACCCTGAAGTTGAAGGTGCATTCGGAGATAATGATCCAGTTGATGTAGTTGAGATTGGTGAAAGCCGTGGGAAAATTGGCGAAATCTTGAAGGTGAAACCATTAGGTGCTTTAGCTATGATAGATGAAGGAGAACTTGACTGGAAAATAGTTGCAATTTCATTGGATGACCCAAGGGCTTCACTTGTAAATGATGTTAACGATGTTGAGCAGCATTTCCCGGGGACTCTTACTGCAATCAGGGACTGGTTTAGAGATTACAAGATTCCAGATGGAAAACCTGCTAACAAGTTTGGCCTTGGCAACAAGGCTGCAAATAAGGAATATGCTCTGAAGGTGATCACAGAGACGAATGAGGCGTGGGCTAAACTTGTAAAAAGATCAGTTCCTTCAGGAGAACTCTCTCTTGTCTAA

Network for GWHGAAZE029839

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00719.20	Pyrophosphatase	22	199	1.10E-47

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01507	ppa	Oxidative phosphorylation	map00190

Gene Ontology

GO term	Ontology	Name
GO:0006796	biological_process	phosphate-containing compound metabolic process
GO:0005737	cellular_component	cytoplasm
GO:0000287	molecular_function	magnesium ion binding
GO:0004427	molecular_function	inorganic diphosphatase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	34.955
	SRR3591706	second leaf	98.249
	SRR3591707	mature leaf	69.417
	SRR3591708	Shoot apex	48.143
	SRR3591709	Stem	24.857
	SRR3591710	White floral bud	37.203
	SRR3591711	White flower	60.088
	SRR3591712	Green floral bud	53.142
	SRR3591713	Yellow flower	88.158
SRP173429	SRR8316895	Juvenile bud stage	29.274
	SRR8316896	Juvenile bud stage	45.568
	SRR8316897	Juvenile bud stage	16.771
	SRR8316894	Third green stage	14.914
	SRR8316900	Third green stage	59.990
	SRR8316901	Third green stage	50.018
	SRR8316898	Complete white stage	10.117
	SRR8316899	Complete white stage	44.360
	SRR8316903	Complete white stage	22.748
	SRR8316902	Silver flowering stage	27.378
	SRR8316904	Silver flowering stage	31.368
	SRR8316905	Silver flowering stage	18.508
	SRR8316906	Gold flowering stage	70.827
	SRR8316907	Gold flowering stage	58.297
	SRR8316908	Gold flowering stage	57.818
SRP132670	SRR6706286	Control	14.714
	SRR6706287	Light intensity 50%	14.393
	SRR6706288	Light intensity 20%	17.998
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	35.959
	CNS0095593	Slightly white alabastrum(diploid) 2	33.368
	CNS0095594	Slightly white alabastrum(diploid) 3	34.601
	CNS0095595	Whole white alabastrum(diploid) 2	32.990
	CNS0095596	Whole white alabastrum(diploid) 3	39.662
	CNS0095597	Whole white alabastrum(diploid) 4	27.644
	CNS0095598	Silvery flower (diploied) 1	19.910
	CNS0095599	Silvery flower (diploied) 2	24.634
	CNS0095600	Silvery flower (diploied) 3	35.366
	CNS0095601	Golden flower (diploid) 1	22.682
	CNS0095602	Golden flower (diploid) 2	28.381
	CNS0095603	Golden flower (diploid) 3	28.249
	CNS0095604	Slightly white alabastrum(tetraploid) 1	31.044
	CNS0095605	Slightly white alabastrum(tetraploid) 2	30.235
	CNS0095606	Slightly white alabastrum(tetraploid) 3	34.415
	CNS0095607	Whole white alabastrum(tetraploid) 1	17.667
	CNS0095608	Whole white alabastrum(tetraploid) 2	25.357
	CNS0095609	Whole white alabastrum(tetraploid) 3	45.318
	CNS0095610	Silvery flower (tetraploid) 1	56.097
	CNS0095611	Silvery flower (tetraploid) 2	72.820
	CNS0095612	Silvery flower (tetraploid) 3	47.810
	CNS0095613	Golden flower (tetraploid) 1	35.318
	CNS0095614	Golden flower (tetraploid) 2	57.348
	CNS0095615	Golden flower (tetraploid) 3	53.744
CRA001975	CRR073297	Stem 1	30.752
	CRR073298	Stem 2	25.672
	CRR073299	Stem 3	27.839
	CRR073300	Leaf 1	23.329
	CRR073301	Leaf 2	28.155
	CRR073302	Leaf 3	29.055
	CRR073303	Juvenile bud 1	41.072
	CRR073304	Juvenile bud 2	38.861
	CRR073305	Juvenile bud 3	33.379
	CRR073306	Third green 1	7.166
	CRR073307	Third green 2	3.538
	CRR073308	Third green 3	6.697
	CRR073309	Second white 1	21.470
	CRR073310	Second white 2	23.025
	CRR073311	Second white 3	21.816
	CRR073312	Silver flowering 1	12.623
	CRR073313	Silver flowering 2	7.634
	CRR073314	Silver flowering 3	9.267
	CRR073315	Gold flowering 1	123.101
	CRR073316	Gold flowering 2	118.583
	CRR073317	Gold flowering 3	76.157
	CRR073318	Tawny withering 1	22.567
	CRR073319	Tawny withering 2	25.119
	CRR073320	Tawny withering 3	21.861