Gene detail

Detail information of GWHGAAZE028165

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010112134.1	1.7458E-105	hypothetical protein L484_019872 [Morus notabilis]
COG	YP_003269709.1	1E-28	cation transport protein ChaC
trEMBL	tr\|W9S9V8\|W9S9V8_9ROSA	7E-106	Uncharacterized protein {ECO:0000313\|EMBL:EXC32759.1}
TAIR10	AT5G26220.1	3E-83	ChaC-like family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	43315707	43317820	-
GWHAAZE00000008	mRNA	43315707	43317820	-
GWHAAZE00000008	exon	43315707	43315800	-
GWHAAZE00000008	exon	43315903	43315974	-
GWHAAZE00000008	exon	43316233	43316273	-
GWHAAZE00000008	exon	43316729	43316785	-
GWHAAZE00000008	exon	43317046	43317102	-
GWHAAZE00000008	exon	43317508	43317584	-
GWHAAZE00000008	exon	43317712	43317820	-
GWHAAZE00000008	CDS	43317712	43317820	-
GWHAAZE00000008	CDS	43317508	43317584	-
GWHAAZE00000008	CDS	43317046	43317102	-
GWHAAZE00000008	CDS	43316729	43316785	-
GWHAAZE00000008	CDS	43316233	43316273	-
GWHAAZE00000008	CDS	43315903	43315974	-
GWHAAZE00000008	CDS	43315707	43315800	-

Transcript Sequence
>GWHTAAZE028199 ATGGTCTTCTGGGTTTTTGGCTATGGCTCATTGGTCTGGAACCCTGGATTTAAGTATGATGAGAAAATGATAGGTTACATCAAGGACTATAGGCGTGTTTTCGATCTTGCGTGCATAGATCACCGAGGTACGCCTGAACACCCTGCAAGAACCTGTACGTTGGAATACAGCGAAGGAGCCATCTGCTGGGGTGCTGCCTATTGTATTCGAGGAGGCGTGGAAAAGGAAAAATTGGCAATGGAGTACTTGGAAAAGAGAGAATGCGAGTATGATCATAAGACGCTGGTGGACTTTTTCAATGAAGGGGACTCTGACCAGCCTGCTATAACAGGAGTCATAGTTTTTACATCTACTCCAGACAAAGAAACAAATAAGTACTACCTTGGGCCCGCCCCATTGGAAGAAATGGCAAGGCAAATTGCAACTGCTTTTGGTCCTTGTGGGAATAACAGAGACTATGTCTTTTTGCTGGAGAAGGCCATGTTTGATATTGGTAAGATTTCGTGA

Network for GWHGAAZE028165

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04752.13	ChaC	3	163	2.70E-42

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K22596	GGCT	Metabolic pathways	map01100
K22596	GGCT	Glutathione metabolism	map00480

Gene Ontology

GO term	Ontology	Name
GO:0006751	biological_process	glutathione catabolic process
GO:0003839	molecular_function	gamma-glutamylcyclotransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	38.178
	SRR3591706	second leaf	89.298
	SRR3591707	mature leaf	10.388
	SRR3591708	Shoot apex	47.345
	SRR3591709	Stem	17.045
	SRR3591710	White floral bud	24.105
	SRR3591711	White flower	25.854
	SRR3591712	Green floral bud	25.778
	SRR3591713	Yellow flower	14.108
SRP173429	SRR8316895	Juvenile bud stage	53.629
	SRR8316896	Juvenile bud stage	42.676
	SRR8316897	Juvenile bud stage	10.013
	SRR8316894	Third green stage	7.055
	SRR8316900	Third green stage	22.501
	SRR8316901	Third green stage	22.211
	SRR8316898	Complete white stage	2.508
	SRR8316899	Complete white stage	37.129
	SRR8316903	Complete white stage	5.587
	SRR8316902	Silver flowering stage	11.965
	SRR8316904	Silver flowering stage	8.052
	SRR8316905	Silver flowering stage	4.661
	SRR8316906	Gold flowering stage	11.832
	SRR8316907	Gold flowering stage	14.139
	SRR8316908	Gold flowering stage	6.749
SRP132670	SRR6706286	Control	15.954
	SRR6706287	Light intensity 50%	21.406
	SRR6706288	Light intensity 20%	20.128
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	45.100
	CNS0095593	Slightly white alabastrum(diploid) 2	52.062
	CNS0095594	Slightly white alabastrum(diploid) 3	53.970
	CNS0095595	Whole white alabastrum(diploid) 2	44.851
	CNS0095596	Whole white alabastrum(diploid) 3	22.890
	CNS0095597	Whole white alabastrum(diploid) 4	43.532
	CNS0095598	Silvery flower (diploied) 1	64.962
	CNS0095599	Silvery flower (diploied) 2	92.120
	CNS0095600	Silvery flower (diploied) 3	39.964
	CNS0095601	Golden flower (diploid) 1	121.676
	CNS0095602	Golden flower (diploid) 2	65.329
	CNS0095603	Golden flower (diploid) 3	67.576
	CNS0095604	Slightly white alabastrum(tetraploid) 1	7.704
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.565
	CNS0095606	Slightly white alabastrum(tetraploid) 3	7.995
	CNS0095607	Whole white alabastrum(tetraploid) 1	12.606
	CNS0095608	Whole white alabastrum(tetraploid) 2	9.410
	CNS0095609	Whole white alabastrum(tetraploid) 3	6.269
	CNS0095610	Silvery flower (tetraploid) 1	3.546
	CNS0095611	Silvery flower (tetraploid) 2	2.226
	CNS0095612	Silvery flower (tetraploid) 3	6.894
	CNS0095613	Golden flower (tetraploid) 1	3.365
	CNS0095614	Golden flower (tetraploid) 2	3.013
	CNS0095615	Golden flower (tetraploid) 3	3.568
CRA001975	CRR073297	Stem 1	36.752
	CRR073298	Stem 2	26.129
	CRR073299	Stem 3	22.617
	CRR073300	Leaf 1	25.538
	CRR073301	Leaf 2	21.824
	CRR073302	Leaf 3	25.097
	CRR073303	Juvenile bud 1	22.536
	CRR073304	Juvenile bud 2	14.149
	CRR073305	Juvenile bud 3	16.037
	CRR073306	Third green 1	16.034
	CRR073307	Third green 2	15.501
	CRR073308	Third green 3	14.738
	CRR073309	Second white 1	14.966
	CRR073310	Second white 2	15.319
	CRR073311	Second white 3	20.569
	CRR073312	Silver flowering 1	18.511
	CRR073313	Silver flowering 2	13.481
	CRR073314	Silver flowering 3	13.083
	CRR073315	Gold flowering 1	45.551
	CRR073316	Gold flowering 2	54.231
	CRR073317	Gold flowering 3	41.300
	CRR073318	Tawny withering 1	32.115
	CRR073319	Tawny withering 2	96.575
	CRR073320	Tawny withering 3	59.402