Gene detail

Detail information of GWHGAAZE028117

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_003632380.2	3.34338E-68	PREDICTED: probable pectinesterase 53 [Vitis vinifera]
COG	YP_003073760.1	3E-21	pectinesterase
Swissprot	tr\|Q8VYZ3\|PME53_ARATH	2E-41	Probable pectinesterase 53 (Precursor)
trEMBL	tr\|F6HZC5\|F6HZC5_VITVI	2E-69	Pectinesterase {ECO:0000256\|RuleBase:RU000589}
TAIR10	AT5G19730.1	2E-35	Pectin lyase-like superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	41172286	41172870	-
GWHAAZE00000008	mRNA	41172286	41172870	-
GWHAAZE00000008	exon	41172286	41172531	-
GWHAAZE00000008	exon	41172661	41172870	-
GWHAAZE00000008	CDS	41172661	41172870	-
GWHAAZE00000008	CDS	41172286	41172531	-

Transcript Sequence
>GWHTAAZE028151 ATGCAGAACACGGCTCCACATGTAATTGGGTCGATTGGAGAACAGGCAGTGGCACTACGCATTTCGGCGAGTAAGGCTGCATTTTACAACTGCAGTTTCTATGGGGCTCAAGACACCCTTTATGATCACAAAGGCCTCCACTATTTCAACAATTGCTTCATCCAAGGCTCTGTCGATTTTATATTCGGCTATGGCAGATCCCTTTATGAGAATTGTTGGTTGAACTCCATATCCAAGAAGGTTGCATCTGTAACTGCTCAAAAACGGAGTACTTCATCAATGTGGAGCGGATTTTCGTTCAAGGACAGTAAGGTAACAGGGAGCAGAAAGGTGTACCTAGGAAGAGCATGGGGTGACTATTCCCGCGGGTCGTCTTCTCATATACATATATGGACCAGATTGTGCTTCCCCAGGGCTGGGGCGACTGGGGCAATCAAAGTCGTGAATCGTACGTAA

Network for GWHGAAZE028117

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01095.20	Pectinesterase	9	122	6.80E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K01051	E3.1.1.11	Metabolic pathways	map01100
		Pentose and glucuronate interconversions	map00040
		Two-component system	map02020

Gene Ontology

GO term	Ontology	Name
GO:0042545	biological_process	cell wall modification
GO:0030599	molecular_function	pectinesterase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.221
	SRR3591706	second leaf	0.375
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	2.282
	SRR3591709	Stem	9.116
	SRR3591710	White floral bud	0.145
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.119
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.497
	SRR8316896	Juvenile bud stage	0.213
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.177
	SRR8316901	Third green stage	0.909
	SRR8316898	Complete white stage	0.141
	SRR8316899	Complete white stage	0.247
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.146
	SRR6706287	Light intensity 50%	0.077
	SRR6706288	Light intensity 20%	0.014
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.232
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.000
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.439
	CNS0095597	Whole white alabastrum(diploid) 4	0.097
	CNS0095598	Silvery flower (diploied) 1	0.074
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.053
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.143
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.204
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.171
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.910
	CRR073302	Leaf 3	0.088
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.019
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.247
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.053
	CRR073319	Tawny withering 2	0.161
	CRR073320	Tawny withering 3	0.449