Gene detail

Detail information of GWHGAAZE027977

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009620517.1	7.74599E-84	PREDICTED: DNA-directed RNA polymerase III subunit RPC6-like [Nicotiana tomentosiformis]
trEMBL	tr\|A0A068UF90\|A0A068UF90_COFCA	1E-80	Coffea canephora DH200=94 genomic scaffold, scaffold_25 {ECO:0000313\|EMBL:CDP07151.1}
TAIR10	AT5G23710.1	5E-44	DNA binding;DNA-directed RNA polymerases

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	33142217	33142816	-
GWHAAZE00000008	mRNA	33142217	33142816	-
GWHAAZE00000008	exon	33142217	33142816	-
GWHAAZE00000008	CDS	33142217	33142816	-

Transcript Sequence
>GWHTAAZE028011 ATGGGAATATGGGCAAACGACATCAAACGAGGCGTAAAACTAGGGGACCGAACCGTAGATGCTGCCATCAGGTCCCTCCACGACAAGAAACTCATAAAACTGGTTGTTAATATCCAAAACAAGGCCAAAAAGCACTACATGGCCATCGAATTCGAACCCTCACCCGAAATCACGGGCGGGAATTGGTACTCGGCAGGTAATCTCGATACTGACTATATCAACAGTCTTAAAGATATGTCATCGAAGATCATTCGTAAGCTTAAGGTAACTACGGCTGAGGGCCTTTTCGACTTTATAACAAAAAATAAACTAAGCCACGTTGATTGCTCAAGCCAGCAAATTAGAGAGATATTGAAGTCTATGGTTTTGGACAATACAATTTTGGAGGTGAAGAGTACTGGATTGGGTGAATATTATTCTATTCCTGTTGGTGATATTTGTTACCGGATTAATGTGACCGGTGGAGACTCGAAAACCGCGGGGGCAATGGCTTCGATCCCGTGTGGCGTTTGTCCGCGGATTAGTCAGTGCACCCCTGATGGTATTATATCTCCTTCTACTTGTGTTTATTACAAGAAATGGTTGAGTGTAGATTTTTAA

Network for GWHGAAZE027977

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05158.13	RNA_pol_Rpc34	2	85	3.60E-21
PF05158.13	RNA_pol_Rpc34	89	196	2.10E-13

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K03025	RPC6, POLR3F	RNA polymerase	map03020
K03025	RPC6, POLR3F	Cytosolic DNA-sensing pathway	map04623

Gene Ontology

GO term	Ontology	Name
GO:0006383	biological_process	transcription by RNA polymerase III
GO:0005666	cellular_component	RNA polymerase III complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.042
	SRR3591706	second leaf	3.184
	SRR3591707	mature leaf	3.996
	SRR3591708	Shoot apex	4.403
	SRR3591709	Stem	3.269
	SRR3591710	White floral bud	2.471
	SRR3591711	White flower	6.631
	SRR3591712	Green floral bud	4.158
	SRR3591713	Yellow flower	6.980
SRP173429	SRR8316895	Juvenile bud stage	5.723
	SRR8316896	Juvenile bud stage	10.916
	SRR8316897	Juvenile bud stage	4.018
	SRR8316894	Third green stage	3.564
	SRR8316900	Third green stage	9.769
	SRR8316901	Third green stage	7.926
	SRR8316898	Complete white stage	2.319
	SRR8316899	Complete white stage	10.305
	SRR8316903	Complete white stage	5.115
	SRR8316902	Silver flowering stage	3.519
	SRR8316904	Silver flowering stage	4.014
	SRR8316905	Silver flowering stage	2.030
	SRR8316906	Gold flowering stage	6.168
	SRR8316907	Gold flowering stage	7.331
	SRR8316908	Gold flowering stage	7.396
SRP132670	SRR6706286	Control	7.833
	SRR6706287	Light intensity 50%	7.156
	SRR6706288	Light intensity 20%	8.612
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	6.022
	CNS0095593	Slightly white alabastrum(diploid) 2	4.854
	CNS0095594	Slightly white alabastrum(diploid) 3	6.620
	CNS0095595	Whole white alabastrum(diploid) 2	7.615
	CNS0095596	Whole white alabastrum(diploid) 3	7.298
	CNS0095597	Whole white alabastrum(diploid) 4	7.051
	CNS0095598	Silvery flower (diploied) 1	3.664
	CNS0095599	Silvery flower (diploied) 2	7.811
	CNS0095600	Silvery flower (diploied) 3	8.405
	CNS0095601	Golden flower (diploid) 1	8.203
	CNS0095602	Golden flower (diploid) 2	8.896
	CNS0095603	Golden flower (diploid) 3	6.831
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.726
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.098
	CNS0095606	Slightly white alabastrum(tetraploid) 3	8.645
	CNS0095607	Whole white alabastrum(tetraploid) 1	3.794
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.697
	CNS0095609	Whole white alabastrum(tetraploid) 3	7.148
	CNS0095610	Silvery flower (tetraploid) 1	7.911
	CNS0095611	Silvery flower (tetraploid) 2	7.055
	CNS0095612	Silvery flower (tetraploid) 3	5.871
	CNS0095613	Golden flower (tetraploid) 1	5.694
	CNS0095614	Golden flower (tetraploid) 2	9.554
	CNS0095615	Golden flower (tetraploid) 3	7.063
CRA001975	CRR073297	Stem 1	6.156
	CRR073298	Stem 2	4.406
	CRR073299	Stem 3	5.140
	CRR073300	Leaf 1	5.825
	CRR073301	Leaf 2	6.422
	CRR073302	Leaf 3	5.585
	CRR073303	Juvenile bud 1	5.708
	CRR073304	Juvenile bud 2	2.526
	CRR073305	Juvenile bud 3	5.014
	CRR073306	Third green 1	3.112
	CRR073307	Third green 2	1.409
	CRR073308	Third green 3	2.805
	CRR073309	Second white 1	2.100
	CRR073310	Second white 2	2.409
	CRR073311	Second white 3	3.913
	CRR073312	Silver flowering 1	3.594
	CRR073313	Silver flowering 2	2.335
	CRR073314	Silver flowering 3	1.282
	CRR073315	Gold flowering 1	3.489
	CRR073316	Gold flowering 2	5.126
	CRR073317	Gold flowering 3	3.344
	CRR073318	Tawny withering 1	5.389
	CRR073319	Tawny withering 2	4.489
	CRR073320	Tawny withering 3	3.804