Gene detail

Detail information of GWHGAAZE027823

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CAA81073.1	2.7348E-100	H-protein [Flaveria cronquistii]
COG	YP_003323225.1	4E-44	glycine cleavage system H protein
Swissprot	tr\|Q39732\|GCSH_FLAAN	7E-102	Glycine cleavage system H protein, mitochondrial (Precursor)
trEMBL	tr\|Q7DLL8\|Q7DLL8_FLACR	1E-100	H-protein {ECO:0000313\|EMBL:CAA81073.1}
TAIR10	AT2G35370.1	1E-67	glycine decarboxylase complex H

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	29087354	29089949	-
GWHAAZE00000008	mRNA	29087354	29089949	-
GWHAAZE00000008	exon	29087354	29087482	-
GWHAAZE00000008	exon	29087749	29087919	-
GWHAAZE00000008	exon	29088879	29088967	-
GWHAAZE00000008	exon	29089859	29089949	-
GWHAAZE00000008	CDS	29089859	29089949	-
GWHAAZE00000008	CDS	29088879	29088967	-
GWHAAZE00000008	CDS	29087749	29087919	-
GWHAAZE00000008	CDS	29087354	29087482	-

Transcript Sequence
>GWHTAAZE027857 ATGGCACTTAGAATGTGGGCTTCTTCAACAGCCAATGCCCTTAAAATCTCCTGTGCTTCAAGGCCTCATCTCTCCAGATGTTTCTCCACTGTTTTGGATGGGTTGAAGTATGCAAGTTCACATGAATGGGTGAAGCATGAGGGGTCAGTGGCTACTATAGGCATCACGGACCATGCTCAGGATCATCTAGGAGAGGTGGTGTTTGTAGATTTGCCAGAAACAGGTGGGGCTGTGAAACAGGGGACTGGATTTGGAGCAGTTGAAAGTGTAAAAGCCACCAGTGATGTTAACTCCCCAATCTCTGGTGAGATTGTTGAGGTTAACGCTAAGCTTACTGAAACCCCTGGTTTGATAAACACAAGCCCATATGAAGGTGGATGGATGATCAAGGTGAAGCCTAGCAGCCCAGCAGAATTAGAGTCATTGATGGGCTCCAAAGAGTACACAAAATTCTGTGAAGAAGAAGATGCTGCACACTAG

Network for GWHGAAZE027823

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01597.20	GCV_H	35	154	3.10E-48

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02437	gcvH, GCSH	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Carbon metabolism	map01200
		Glyoxylate and dicarboxylate metabolism	map00630
		Glycine, serine and threonine metabolism	map00260

Gene Ontology

GO term	Ontology	Name
GO:0019464	biological_process	glycine decarboxylation via glycine cleavage system
GO:0005960	cellular_component	glycine cleavage complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	330.115
	SRR3591706	second leaf	1902.869
	SRR3591707	mature leaf	1937.198
	SRR3591708	Shoot apex	801.367
	SRR3591709	Stem	208.923
	SRR3591710	White floral bud	31.147
	SRR3591711	White flower	29.475
	SRR3591712	Green floral bud	28.152
	SRR3591713	Yellow flower	2.281
SRP173429	SRR8316895	Juvenile bud stage	90.885
	SRR8316896	Juvenile bud stage	67.863
	SRR8316897	Juvenile bud stage	57.907
	SRR8316894	Third green stage	27.740
	SRR8316900	Third green stage	47.676
	SRR8316901	Third green stage	40.301
	SRR8316898	Complete white stage	10.258
	SRR8316899	Complete white stage	29.862
	SRR8316903	Complete white stage	19.089
	SRR8316902	Silver flowering stage	0.442
	SRR8316904	Silver flowering stage	0.913
	SRR8316905	Silver flowering stage	0.088
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.313
	SRR8316908	Gold flowering stage	1.223
SRP132670	SRR6706286	Control	62.925
	SRR6706287	Light intensity 50%	50.969
	SRR6706288	Light intensity 20%	46.464
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	68.894
	CNS0095593	Slightly white alabastrum(diploid) 2	57.069
	CNS0095594	Slightly white alabastrum(diploid) 3	53.351
	CNS0095595	Whole white alabastrum(diploid) 2	47.179
	CNS0095596	Whole white alabastrum(diploid) 3	41.053
	CNS0095597	Whole white alabastrum(diploid) 4	24.360
	CNS0095598	Silvery flower (diploied) 1	208.106
	CNS0095599	Silvery flower (diploied) 2	144.301
	CNS0095600	Silvery flower (diploied) 3	20.647
	CNS0095601	Golden flower (diploid) 1	210.606
	CNS0095602	Golden flower (diploid) 2	76.018
	CNS0095603	Golden flower (diploid) 3	69.054
	CNS0095604	Slightly white alabastrum(tetraploid) 1	89.716
	CNS0095605	Slightly white alabastrum(tetraploid) 2	92.599
	CNS0095606	Slightly white alabastrum(tetraploid) 3	117.761
	CNS0095607	Whole white alabastrum(tetraploid) 1	36.562
	CNS0095608	Whole white alabastrum(tetraploid) 2	32.124
	CNS0095609	Whole white alabastrum(tetraploid) 3	58.601
	CNS0095610	Silvery flower (tetraploid) 1	2.051
	CNS0095611	Silvery flower (tetraploid) 2	17.113
	CNS0095612	Silvery flower (tetraploid) 3	4.372
	CNS0095613	Golden flower (tetraploid) 1	0.232
	CNS0095614	Golden flower (tetraploid) 2	1.064
	CNS0095615	Golden flower (tetraploid) 3	0.285
CRA001975	CRR073297	Stem 1	180.519
	CRR073298	Stem 2	156.617
	CRR073299	Stem 3	180.190
	CRR073300	Leaf 1	23.715
	CRR073301	Leaf 2	35.341
	CRR073302	Leaf 3	30.383
	CRR073303	Juvenile bud 1	7.585
	CRR073304	Juvenile bud 2	9.910
	CRR073305	Juvenile bud 3	14.466
	CRR073306	Third green 1	0.800
	CRR073307	Third green 2	0.502
	CRR073308	Third green 3	2.357
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.331
	CRR073311	Second white 3	0.248
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.317
	CRR073314	Silver flowering 3	1.290
	CRR073315	Gold flowering 1	2035.194
	CRR073316	Gold flowering 2	1696.176
	CRR073317	Gold flowering 3	1768.856
	CRR073318	Tawny withering 1	95.952
	CRR073319	Tawny withering 2	141.078
	CRR073320	Tawny withering 3	76.025