Gene detail

Detail information of GWHGAAZE027405

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009368592.1	2.89828E-88	PREDICTED: protein SOMBRERO-like [Pyrus x bretschneideri]
Swissprot	tr\|Q5Z6B6\|NAC76_ORYSJ	9E-85	NAC domain-containing protein 76
trEMBL	tr\|M5WZ81\|M5WZ81_PRUPE	2E-88	Uncharacterized protein {ECO:0000313\|EMBL:EMJ14643.1}
TAIR10	AT1G79580.3	5E-61	NAC (No Apical Meristem) domain transcriptional regulator superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	19051860	19052782	+
GWHAAZE00000008	mRNA	19051860	19052782	+
GWHAAZE00000008	exon	19051860	19052097	+
GWHAAZE00000008	exon	19052313	19052782	+
GWHAAZE00000008	CDS	19051860	19052097	+
GWHAAZE00000008	CDS	19052313	19052782	+

Transcript Sequence
>GWHTAAZE027439 ATGGAATTAGGAAGAGGAGGAGGTCATCAAGGTGGAAACATGAATATTATTCATGATGGGCAGGGGCAGGGGCAGGGGCGGGAGGGAGTATGTGTTGTGCCACCAGGGTTCAGGTTCCATCCGACGGATGAGGAACTACTATACTATTACCTGAGGAAGAAGGTTTCTTACGAATCCATCGACCTTGATGTCATTAGGGAAGTTGATCTCAACAAACTCGAGCCTTGGGACCTCAAAGAAAAATGTAAGATAGGATCTGGCCCTCAGAACGAGTGGTATTTTTTCAGTCACAAGGACAAAAAATATCCGACTGGGACTCGCACAAATCGAGCCACTGCTGCTGGGTTTTGGAAGGCCACGGGGAGGGACAAGGCGATCCACCTCACCGGCAAGAGAATTGGGATGCGAAAGACACTCGTCTTTTACACTGGACGCGCCCCTCACGGCCAAAAGACCGACTGGATCATGCACGAGTATCGTCTCGATGAAGATCACATTACTAATAATCCTGATGTTCAGGTATATATTTATCGATCCCCATCCCAATATCCATCTCTCTTGTACGTTCATACAATACATATATACATATTTAATTAATTTAATTTAATTTAATATTTGGCGTATATATACGTGTGGCCGGGGTCAGTCACTGCAGGAAGATGGATGGGTTGTCTGCCGAGTATTCAAGAAAAAGATTCACAGCAGTAA

Network for GWHGAAZE027405

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	34	161	1.70E-38

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.151
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.186
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.948
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	1.193
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.148
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.455
	SRR8316894	Third green stage	0.102
	SRR8316900	Third green stage	1.749
	SRR8316901	Third green stage	0.501
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.052
	SRR8316904	Silver flowering stage	0.146
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.203
	SRR8316907	Gold flowering stage	0.098
	SRR8316908	Gold flowering stage	0.366
SRP132670	SRR6706286	Control	0.968
	SRR6706287	Light intensity 50%	1.116
	SRR6706288	Light intensity 20%	0.711
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.156
	CNS0095593	Slightly white alabastrum(diploid) 2	0.631
	CNS0095594	Slightly white alabastrum(diploid) 3	0.057
	CNS0095595	Whole white alabastrum(diploid) 2	2.563
	CNS0095596	Whole white alabastrum(diploid) 3	1.745
	CNS0095597	Whole white alabastrum(diploid) 4	3.951
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.582
	CNS0095600	Silvery flower (diploied) 3	0.056
	CNS0095601	Golden flower (diploid) 1	0.193
	CNS0095602	Golden flower (diploid) 2	0.104
	CNS0095603	Golden flower (diploid) 3	0.001
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.620
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.336
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.235
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.804
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.235
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.891
	CNS0095610	Silvery flower (tetraploid) 1	0.108
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.215
	CNS0095613	Golden flower (tetraploid) 1	0.435
	CNS0095614	Golden flower (tetraploid) 2	0.283
	CNS0095615	Golden flower (tetraploid) 3	0.506
CRA001975	CRR073297	Stem 1	0.128
	CRR073298	Stem 2	0.192
	CRR073299	Stem 3	0.013
	CRR073300	Leaf 1	0.895
	CRR073301	Leaf 2	0.683
	CRR073302	Leaf 3	0.192
	CRR073303	Juvenile bud 1	0.777
	CRR073304	Juvenile bud 2	0.825
	CRR073305	Juvenile bud 3	0.258
	CRR073306	Third green 1	0.099
	CRR073307	Third green 2	0.084
	CRR073308	Third green 3	0.258
	CRR073309	Second white 1	0.005
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.079
	CRR073312	Silver flowering 1	0.261
	CRR073313	Silver flowering 2	0.105
	CRR073314	Silver flowering 3	0.187
	CRR073315	Gold flowering 1	0.116
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.076
	CRR073318	Tawny withering 1	0.062
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.000