Gene detail

Detail information of GWHGAAZE027285

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_008226979.1	1.37962E-58	PREDICTED: condensin complex subunit 2-like [Prunus mume]
Swissprot	tr\|Q564K3\|CND2_ARATH	6E-30	Condensin complex subunit 2
trEMBL	tr\|A0A061F4L2\|A0A061F4L2_THECC	7E-54	Condensin complex subunit 2 {ECO:0000256\|PIRNR:PIRNR017126}
TAIR10	AT2G32590.1	6E-27	Without detailed annotation

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	17177869	17180172	-
GWHAAZE00000008	mRNA	17177869	17180172	-
GWHAAZE00000008	exon	17180091	17180172	-
GWHAAZE00000008	exon	17179295	17179440	-
GWHAAZE00000008	exon	17178636	17178746	-
GWHAAZE00000008	exon	17177869	17178102	-
GWHAAZE00000008	CDS	17180091	17180172	-
GWHAAZE00000008	CDS	17179295	17179440	-
GWHAAZE00000008	CDS	17178636	17178746	-
GWHAAZE00000008	CDS	17177869	17178102	-

Transcript Sequence
>GWHTAAZE027319 ATGTTTCTTGATATTATGCTTACAAAATTTGCCATCTCTCAAATGCAATTGTTCCTTATAAAAAATGACCTCCACGGGGCATATAATAACTCATGGCAGCAGAACAATAACTCTGACGAACAGTTGCCATCATGGGACAATGAAAGTAGGTTCGATGGCCAATATGATGATGGATATGTTCATGGTGATCTGGATGACTCAGTTAATCTTGTCTCTCAGCCTTGTCAGGTAACCAAAGTTGAAGTTCAATATGACAAAACTGTTAAACAAGTCGATATGCATGTGTTAAAGGGAGCACTGTGGGATCACATACGTGACTCTATTCAAGAGTCTAAACTGGTTTGTAAAGACGCATTCTCCTTCAAGCACATTTTAGCCACCTTTCCTGATGAATGCCGTGAAGCAGTGCCAAAGGATATATCCCCTCATTTGTGTTTCATATGCCTACTGCATTTGGCTAACGAGCACGGTTTAAGCATCTATGACTGCCCCACCTTGGATGATCTCACTATACTCCTTCCCTCGTCTTGCCCAAGCATGCTAATTGATTCAGCCATCGAGCCATCAGGGTAG

Network for GWHGAAZE027285

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF05786.15	Cnd2	63	171	1.00E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K06676	BRRN1, BRN1, CAPH	Cell cycle - yeast	map04111

Gene Ontology

GO term	Ontology	Name
GO:0007076	biological_process	mitotic chromosome condensation
GO:0000796	cellular_component	condensin complex

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.293
	SRR3591706	second leaf	1.558
	SRR3591707	mature leaf	0.075
	SRR3591708	Shoot apex	5.109
	SRR3591709	Stem	4.900
	SRR3591710	White floral bud	0.770
	SRR3591711	White flower	0.390
	SRR3591712	Green floral bud	1.751
	SRR3591713	Yellow flower	0.670
SRP173429	SRR8316895	Juvenile bud stage	0.981
	SRR8316896	Juvenile bud stage	1.546
	SRR8316897	Juvenile bud stage	0.214
	SRR8316894	Third green stage	0.858
	SRR8316900	Third green stage	1.795
	SRR8316901	Third green stage	1.285
	SRR8316898	Complete white stage	0.183
	SRR8316899	Complete white stage	2.285
	SRR8316903	Complete white stage	0.358
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.019
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.573
	SRR6706287	Light intensity 50%	0.377
	SRR6706288	Light intensity 20%	0.649
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	2.864
	CNS0095593	Slightly white alabastrum(diploid) 2	2.444
	CNS0095594	Slightly white alabastrum(diploid) 3	2.926
	CNS0095595	Whole white alabastrum(diploid) 2	1.154
	CNS0095596	Whole white alabastrum(diploid) 3	1.083
	CNS0095597	Whole white alabastrum(diploid) 4	0.262
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.667
	CNS0095600	Silvery flower (diploied) 3	0.567
	CNS0095601	Golden flower (diploid) 1	0.726
	CNS0095602	Golden flower (diploid) 2	0.007
	CNS0095603	Golden flower (diploid) 3	0.315
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.545
	CNS0095605	Slightly white alabastrum(tetraploid) 2	1.539
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.316
	CNS0095607	Whole white alabastrum(tetraploid) 1	2.374
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.832
	CNS0095609	Whole white alabastrum(tetraploid) 3	1.172
	CNS0095610	Silvery flower (tetraploid) 1	0.027
	CNS0095611	Silvery flower (tetraploid) 2	0.654
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.287
	CNS0095614	Golden flower (tetraploid) 2	1.251
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.890
	CRR073298	Stem 2	0.860
	CRR073299	Stem 3	1.860
	CRR073300	Leaf 1	0.973
	CRR073301	Leaf 2	1.658
	CRR073302	Leaf 3	0.199
	CRR073303	Juvenile bud 1	0.429
	CRR073304	Juvenile bud 2	0.759
	CRR073305	Juvenile bud 3	1.190
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.162
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.412
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.662
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.090
	CRR073315	Gold flowering 1	0.221
	CRR073316	Gold flowering 2	0.198
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	1.241
	CRR073319	Tawny withering 2	0.848
	CRR073320	Tawny withering 3	0.940