Gene detail

Detail information of GWHGAAZE027052

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010062724.1	3.57147E-67	PREDICTED: probable glutathione S-transferase [Eucalyptus grandis]
COG	YP_007096787.1	3E-10	glutathione S-transferase
Swissprot	tr\|P49332\|GSTXC_TOBAC	4E-66	Probable glutathione S-transferase parC
trEMBL	tr\|M1B668\|M1B668_SOLTU	1E-67	Uncharacterized protein {ECO:0000313\|EnsemblPlants:PGSC0003DMT400037986}
TAIR10	AT1G17180.1	6E-43	glutathione S-transferase TAU 25

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000008	gene	14073156	14074076	+
GWHAAZE00000008	mRNA	14073156	14074076	+
GWHAAZE00000008	exon	14073156	14073323	+
GWHAAZE00000008	exon	14073837	14074076	+
GWHAAZE00000008	CDS	14073156	14073323	+
GWHAAZE00000008	CDS	14073837	14074076	+

Transcript Sequence
>GWHTAAZE027086 ATGAACCCGGTTCACAAGAAAATCCCGGTTCTCATCCACAATGGTAAACCGTTCTGTGAATCACTCATTGGAGTACAGTACATTGAAGAGGTGTGGATGGATAAAGCTCCATTGCTACCTTCTGATCCTTATGAGAGATCTCAAGCTAAGTTCTGGGCTGATTTAATTCTTTATGAACTTGGGGGTAAATTACGGAAAACAAAAGAAGAACAAGAGGCAGCGAAAAAGGAATACATACAATTCCTCAAGTTGCTAGAAGGAGAGCTCAGTTATAAGCCCTTCTTTGGAGGCGAGAACTTTGGGTATTTGGACATCGCTCTCATCGGATTTTATAGCTGGTTTTATGCGTATGAGATTTGTGGCAACTTCAGCGTAGAGGCACAGTGCCCTCAGTTGATAGCAATATAG

Network for GWHGAAZE027052

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02798.21	GST_N	2	29	4.30E-05
PF13410.7	GST_C_2	72	117	9.70E-09

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00799	GST, gst	Metabolic pathways	map01100
		Glutathione metabolism	map00480
		Metabolism of xenobiotics by cytochrome P450	map00980
		Drug metabolism - cytochrome P450	map00982
		Drug metabolism - other enzymes	map00983
		Longevity regulating pathway - worm	map04212

Gene Ontology

GO term	Ontology	Name
GO:0005515	molecular_function	protein binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.115
	SRR3591708	Shoot apex	0.481
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	0.000
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.016
	SRR3591713	Yellow flower	0.043
SRP173429	SRR8316895	Juvenile bud stage	0.043
	SRR8316896	Juvenile bud stage	0.000
	SRR8316897	Juvenile bud stage	0.074
	SRR8316894	Third green stage	0.387
	SRR8316900	Third green stage	0.182
	SRR8316901	Third green stage	0.000
	SRR8316898	Complete white stage	0.128
	SRR8316899	Complete white stage	0.127
	SRR8316903	Complete white stage	0.333
	SRR8316902	Silver flowering stage	0.013
	SRR8316904	Silver flowering stage	0.016
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.157
	SRR8316907	Gold flowering stage	0.180
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.093
	SRR6706287	Light intensity 50%	0.127
	SRR6706288	Light intensity 20%	0.033
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.522
	CNS0095593	Slightly white alabastrum(diploid) 2	0.000
	CNS0095594	Slightly white alabastrum(diploid) 3	0.101
	CNS0095595	Whole white alabastrum(diploid) 2	0.491
	CNS0095596	Whole white alabastrum(diploid) 3	0.141
	CNS0095597	Whole white alabastrum(diploid) 4	0.013
	CNS0095598	Silvery flower (diploied) 1	1.065
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.276
	CNS0095601	Golden flower (diploid) 1	0.122
	CNS0095602	Golden flower (diploid) 2	0.010
	CNS0095603	Golden flower (diploid) 3	0.186
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.490
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.219
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.099
	CNS0095612	Silvery flower (tetraploid) 3	0.017
	CNS0095613	Golden flower (tetraploid) 1	0.028
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.026
CRA001975	CRR073297	Stem 1	0.226
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.015
	CRR073300	Leaf 1	0.129
	CRR073301	Leaf 2	0.233
	CRR073302	Leaf 3	0.004
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.113
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.042
	CRR073309	Second white 1	0.056
	CRR073310	Second white 2	0.016
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.051
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.017
	CRR073315	Gold flowering 1	1.020
	CRR073316	Gold flowering 2	1.782
	CRR073317	Gold flowering 3	0.226
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.504
	CRR073320	Tawny withering 3	0.000