Gene detail

Detail information of GWHGAAZE026001

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002284738.1	1.97334E-79	PREDICTED: probable histone H2A variant 3 [Vitis vinifera]
Swissprot	tr\|Q84MP7\|H2AV3_ORYSJ	6E-72	Probable histone H2A variant 3
trEMBL	tr\|D7SUM0\|D7SUM0_VITVI	7E-80	Histone H2A {ECO:0000256\|RuleBase:RU003556}
TAIR10	AT1G52740.1	8E-56	histone H2A protein 9

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	71623588	71630484	-
GWHAAZE00000007	mRNA	71623588	71630484	-
GWHAAZE00000007	exon	71630341	71630484	-
GWHAAZE00000007	exon	71623588	71623884	-
GWHAAZE00000007	CDS	71630341	71630484	-
GWHAAZE00000007	CDS	71623588	71623884	-

Transcript Sequence
>GWHTAAZE026035 ATGTCGGGAAAAGGAGCGAAAGGATTGATAACGGGTAAAACCCCAGCAGCAGGAGGAGGAGGAGGAGGTAAGGGCAAGGACAAGGACAAAGACAAAGACTCTAAGAAGGCTCCTGTCTCTCGCTCCTCTCGTGCTGGTCTTCAGTTCCCTGTGGGCCGTATCCACCGCCTGCTGAAGTCTCGGGTCACAGCCAGTGGAAGAGTAGGTGCAACAGCAGCTGTATACTCGGCAGCTATATTGGAGTACCTGACGGCCGAAGTGCTAGAGTTGGCTGGAAATGCGAGCAAGGACTTGAAGGTGAAGCGCATCACTCCTCGGCATTTGCAGCTCGCTATACGCGGTGATGAAGAGCTCGATACGCTTATTAAAGGAACTATCGCTGGTGGTGGTGTGATCCCTCACATTCACAAGTCACTCATCAACAAGTCCTCCAAGGACTGA

Network for GWHGAAZE026001

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00125.25	Histone	28	115	5.00E-18
PF16211.6	Histone_H2A_C	116	145	7.20E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11251	H2A	Necroptosis	map04217

Gene Ontology

GO term	Ontology	Name
GO:0000786	cellular_component	nucleosome
GO:0005634	cellular_component	nucleus
GO:0003677	molecular_function	DNA binding
GO:0046982	molecular_function	protein heterodimerization activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	41.396
	SRR3591706	second leaf	23.028
	SRR3591707	mature leaf	27.295
	SRR3591708	Shoot apex	52.293
	SRR3591709	Stem	42.086
	SRR3591710	White floral bud	49.011
	SRR3591711	White flower	49.949
	SRR3591712	Green floral bud	54.521
	SRR3591713	Yellow flower	47.108
SRP173429	SRR8316895	Juvenile bud stage	44.321
	SRR8316896	Juvenile bud stage	55.022
	SRR8316897	Juvenile bud stage	25.009
	SRR8316894	Third green stage	20.944
	SRR8316900	Third green stage	49.622
	SRR8316901	Third green stage	68.267
	SRR8316898	Complete white stage	23.707
	SRR8316899	Complete white stage	80.190
	SRR8316903	Complete white stage	35.697
	SRR8316902	Silver flowering stage	27.969
	SRR8316904	Silver flowering stage	27.680
	SRR8316905	Silver flowering stage	16.267
	SRR8316906	Gold flowering stage	66.850
	SRR8316907	Gold flowering stage	50.472
	SRR8316908	Gold flowering stage	61.801
SRP132670	SRR6706286	Control	34.396
	SRR6706287	Light intensity 50%	35.843
	SRR6706288	Light intensity 20%	38.035
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	60.839
	CNS0095593	Slightly white alabastrum(diploid) 2	66.137
	CNS0095594	Slightly white alabastrum(diploid) 3	60.300
	CNS0095595	Whole white alabastrum(diploid) 2	45.855
	CNS0095596	Whole white alabastrum(diploid) 3	41.099
	CNS0095597	Whole white alabastrum(diploid) 4	39.352
	CNS0095598	Silvery flower (diploied) 1	47.497
	CNS0095599	Silvery flower (diploied) 2	50.906
	CNS0095600	Silvery flower (diploied) 3	46.231
	CNS0095601	Golden flower (diploid) 1	48.623
	CNS0095602	Golden flower (diploid) 2	42.556
	CNS0095603	Golden flower (diploid) 3	43.469
	CNS0095604	Slightly white alabastrum(tetraploid) 1	62.202
	CNS0095605	Slightly white alabastrum(tetraploid) 2	53.626
	CNS0095606	Slightly white alabastrum(tetraploid) 3	96.133
	CNS0095607	Whole white alabastrum(tetraploid) 1	41.243
	CNS0095608	Whole white alabastrum(tetraploid) 2	30.236
	CNS0095609	Whole white alabastrum(tetraploid) 3	47.671
	CNS0095610	Silvery flower (tetraploid) 1	49.384
	CNS0095611	Silvery flower (tetraploid) 2	40.569
	CNS0095612	Silvery flower (tetraploid) 3	30.848
	CNS0095613	Golden flower (tetraploid) 1	37.338
	CNS0095614	Golden flower (tetraploid) 2	46.474
	CNS0095615	Golden flower (tetraploid) 3	29.140
CRA001975	CRR073297	Stem 1	46.761
	CRR073298	Stem 2	50.902
	CRR073299	Stem 3	65.904
	CRR073300	Leaf 1	48.557
	CRR073301	Leaf 2	45.389
	CRR073302	Leaf 3	35.681
	CRR073303	Juvenile bud 1	43.167
	CRR073304	Juvenile bud 2	28.082
	CRR073305	Juvenile bud 3	31.984
	CRR073306	Third green 1	17.380
	CRR073307	Third green 2	13.966
	CRR073308	Third green 3	13.753
	CRR073309	Second white 1	27.140
	CRR073310	Second white 2	22.713
	CRR073311	Second white 3	14.654
	CRR073312	Silver flowering 1	20.522
	CRR073313	Silver flowering 2	28.908
	CRR073314	Silver flowering 3	22.466
	CRR073315	Gold flowering 1	35.478
	CRR073316	Gold flowering 2	37.917
	CRR073317	Gold flowering 3	44.611
	CRR073318	Tawny withering 1	43.746
	CRR073319	Tawny withering 2	42.938
	CRR073320	Tawny withering 3	61.356