Gene detail

Detail information of GWHGAAZE025564

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002285026.1	4.1645E-31	PREDICTED: protein arginine N-methyltransferase PRMT10 [Vitis vinifera]
Swissprot	tr\|Q9MAT5\|ANM10_ARATH	7E-23	Protein arginine N-methyltransferase PRMT10
trEMBL	tr\|M5VW30\|M5VW30_PRUPE	2E-30	Uncharacterized protein {ECO:0000313\|EMBL:EMJ05597.1}
TAIR10	AT1G04870.2	3E-19	protein arginine methyltransferase 10

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	63394975	63395265	+
GWHAAZE00000007	mRNA	63394975	63395265	+
GWHAAZE00000007	exon	63394975	63395178	+
GWHAAZE00000007	exon	63395254	63395265	+
GWHAAZE00000007	CDS	63394975	63395178	+
GWHAAZE00000007	CDS	63395254	63395265	+

Transcript Sequence
>GWHTAAZE025598 ATGGGGAGCTCAGCTAACGGCTTCGCCGGAGACCGTATGTCCACCAGTAACGGAGGAGGCGGCGTGGATAAGGGAGTAGATTTCGCAAACTATTTCTGCACTTACGCCTTTCTCTATCACCAGAAAGAGATGCTCTCTGATCGTGTTCGTATGGACGCTTACTTCAACTCCATTTTTAAGAACAAAACTCACTTCCTTGGAAAGGCTAAAGTGTGA

Network for GWHGAAZE025564

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K11434	PRMT1	FoxO signaling pathway	map04068
K11434	PRMT1	Glucagon signaling pathway	map04922

Gene Ontology

GO term	Ontology	Name

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	33.529
	SRR3591706	second leaf	20.680
	SRR3591707	mature leaf	10.423
	SRR3591708	Shoot apex	39.884
	SRR3591709	Stem	17.098
	SRR3591710	White floral bud	16.878
	SRR3591711	White flower	28.762
	SRR3591712	Green floral bud	28.727
	SRR3591713	Yellow flower	20.934
SRP173429	SRR8316895	Juvenile bud stage	28.704
	SRR8316896	Juvenile bud stage	38.103
	SRR8316897	Juvenile bud stage	17.575
	SRR8316894	Third green stage	16.318
	SRR8316900	Third green stage	42.512
	SRR8316901	Third green stage	44.712
	SRR8316898	Complete white stage	12.155
	SRR8316899	Complete white stage	38.118
	SRR8316903	Complete white stage	18.135
	SRR8316902	Silver flowering stage	17.784
	SRR8316904	Silver flowering stage	16.552
	SRR8316905	Silver flowering stage	13.073
	SRR8316906	Gold flowering stage	35.108
	SRR8316907	Gold flowering stage	34.673
	SRR8316908	Gold flowering stage	41.085
SRP132670	SRR6706286	Control	45.999
	SRR6706287	Light intensity 50%	50.115
	SRR6706288	Light intensity 20%	55.441
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.677
	CNS0095593	Slightly white alabastrum(diploid) 2	17.750
	CNS0095594	Slightly white alabastrum(diploid) 3	20.596
	CNS0095595	Whole white alabastrum(diploid) 2	25.413
	CNS0095596	Whole white alabastrum(diploid) 3	30.350
	CNS0095597	Whole white alabastrum(diploid) 4	25.906
	CNS0095598	Silvery flower (diploied) 1	13.805
	CNS0095599	Silvery flower (diploied) 2	21.578
	CNS0095600	Silvery flower (diploied) 3	24.654
	CNS0095601	Golden flower (diploid) 1	17.585
	CNS0095602	Golden flower (diploid) 2	26.892
	CNS0095603	Golden flower (diploid) 3	28.676
	CNS0095604	Slightly white alabastrum(tetraploid) 1	35.005
	CNS0095605	Slightly white alabastrum(tetraploid) 2	37.920
	CNS0095606	Slightly white alabastrum(tetraploid) 3	38.756
	CNS0095607	Whole white alabastrum(tetraploid) 1	31.377
	CNS0095608	Whole white alabastrum(tetraploid) 2	27.299
	CNS0095609	Whole white alabastrum(tetraploid) 3	41.540
	CNS0095610	Silvery flower (tetraploid) 1	18.583
	CNS0095611	Silvery flower (tetraploid) 2	33.926
	CNS0095612	Silvery flower (tetraploid) 3	20.748
	CNS0095613	Golden flower (tetraploid) 1	11.490
	CNS0095614	Golden flower (tetraploid) 2	17.438
	CNS0095615	Golden flower (tetraploid) 3	28.190
CRA001975	CRR073297	Stem 1	51.228
	CRR073298	Stem 2	48.595
	CRR073299	Stem 3	48.395
	CRR073300	Leaf 1	55.579
	CRR073301	Leaf 2	55.334
	CRR073302	Leaf 3	59.835
	CRR073303	Juvenile bud 1	48.944
	CRR073304	Juvenile bud 2	43.565
	CRR073305	Juvenile bud 3	42.838
	CRR073306	Third green 1	28.595
	CRR073307	Third green 2	20.939
	CRR073308	Third green 3	22.905
	CRR073309	Second white 1	25.318
	CRR073310	Second white 2	38.385
	CRR073311	Second white 3	18.788
	CRR073312	Silver flowering 1	22.071
	CRR073313	Silver flowering 2	26.824
	CRR073314	Silver flowering 3	27.425
	CRR073315	Gold flowering 1	13.220
	CRR073316	Gold flowering 2	20.699
	CRR073317	Gold flowering 3	16.422
	CRR073318	Tawny withering 1	28.222
	CRR073319	Tawny withering 2	27.210
	CRR073320	Tawny withering 3	36.207