Gene detail

Detail information of GWHGAAZE025474

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002297879.2	2.3017E-142	ubiquinol-cytochrome C reductase iron-sulfur subunit family protein [Populus trichocarpa]
COG	YP_006590199.1	1E-60	ubiquinol-cytochrome c reductase iron-sulfur subunit
Swissprot	tr\|P49729\|UCRI1_TOBAC	7E-142	Cytochrome b-c1 complex subunit Rieske-1, mitochondrial (Precursor; Fragment)
trEMBL	tr\|B9GMU2\|B9GMU2_POPTR	9E-143	Cytochrome b-c1 complex subunit Rieske, mitochondrial {ECO:0000256\|RuleBase:RU004494}
TAIR10	AT5G13440.1	6E-108	Ubiquinol-cytochrome C reductase iron-sulfur subunit

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	61723016	61723672	+
GWHAAZE00000007	mRNA	61723016	61723672	+
GWHAAZE00000007	exon	61723016	61723672	+
GWHAAZE00000007	CDS	61723016	61723672	+

Transcript Sequence
>GWHTAAZE025508 ATGGTTGTTACAGGTTTCGTTTCAGGCCCTCTCACCTCAGAAAATGAAAACAGCATCATTCCCAACATTCCACCCACTGTGGCCGCCATTAAGAACCCTACCTCAAAGATAGTCTACGATGAACACAACCATGAACGTTACCCTCCGGGTGACCCCACCAAACGCGCATTCGCCTACTTCGTCTTGACAGGTGGCAGGTTCGTGTACGCCTCCCTCCTCCGCCTCCTCATTCTCAAGTTTGTTCTGAGCATGTCCGCTAGCAAAGATGTTCTTGCACTTGCCTCTCTTGAAGTTGACCTGTCCAGCATCGACCCTGGTACCACCGTAACCGTTAAGTGGCGCGGCAAGCCTGTCTTCATTAGGCGCCGGACAGAGGATGATATAAAGCTGGCGAACAGCATTGACTTAGCTTCACTGCGGGACCCACAGGAGGATGCTGTCAGGGTCAAGAATCCCGAGTGGCTTGTTGTGATTGGTGTTTGCACTCATCTCGGTTGCATCCCCTTGCCCAATGCGGGTGATTTTGGGGGCTGGTTTTGCCCATGCCATGGTTCTCATTACGATATCTCTGGGAGAATTCGGAAGGGGCCTGCTCCGTACAATCTGGAGGTACCCACTTATAGTTTCTTGACTGAGAACAAGATATTGATTGGATAA

Network for GWHGAAZE025474

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02921.15	UCR_TM	33	89	2.30E-12
PF00355.27	Rieske	101	204	3.50E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00411	UQCRFS1, RIP1, petA	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Two-component system	map02020
		Cardiac muscle contraction	map04260
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016020	cellular_component	membrane
GO:0008121	molecular_function	ubiquinol-cytochrome-c reductase activity
GO:0016491	molecular_function	oxidoreductase activity
GO:0051537	molecular_function	2 iron, 2 sulfur cluster binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.299
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.289
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.773
	SRR3591710	White floral bud	30.983
	SRR3591711	White flower	1.569
	SRR3591712	Green floral bud	76.939
	SRR3591713	Yellow flower	1.852
SRP173429	SRR8316895	Juvenile bud stage	27.607
	SRR8316896	Juvenile bud stage	67.358
	SRR8316897	Juvenile bud stage	20.729
	SRR8316894	Third green stage	15.331
	SRR8316900	Third green stage	53.723
	SRR8316901	Third green stage	59.854
	SRR8316898	Complete white stage	1.471
	SRR8316899	Complete white stage	1.579
	SRR8316903	Complete white stage	0.933
	SRR8316902	Silver flowering stage	1.979
	SRR8316904	Silver flowering stage	1.546
	SRR8316905	Silver flowering stage	1.003
	SRR8316906	Gold flowering stage	3.061
	SRR8316907	Gold flowering stage	4.059
	SRR8316908	Gold flowering stage	3.300
SRP132670	SRR6706286	Control	24.473
	SRR6706287	Light intensity 50%	24.438
	SRR6706288	Light intensity 20%	22.774
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	66.177
	CNS0095593	Slightly white alabastrum(diploid) 2	39.743
	CNS0095594	Slightly white alabastrum(diploid) 3	87.932
	CNS0095595	Whole white alabastrum(diploid) 2	68.639
	CNS0095596	Whole white alabastrum(diploid) 3	102.722
	CNS0095597	Whole white alabastrum(diploid) 4	65.900
	CNS0095598	Silvery flower (diploied) 1	0.799
	CNS0095599	Silvery flower (diploied) 2	2.425
	CNS0095600	Silvery flower (diploied) 3	3.291
	CNS0095601	Golden flower (diploid) 1	2.971
	CNS0095602	Golden flower (diploid) 2	2.025
	CNS0095603	Golden flower (diploid) 3	2.098
	CNS0095604	Slightly white alabastrum(tetraploid) 1	103.112
	CNS0095605	Slightly white alabastrum(tetraploid) 2	106.694
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.727
	CNS0095607	Whole white alabastrum(tetraploid) 1	128.891
	CNS0095608	Whole white alabastrum(tetraploid) 2	129.337
	CNS0095609	Whole white alabastrum(tetraploid) 3	69.425
	CNS0095610	Silvery flower (tetraploid) 1	1.242
	CNS0095611	Silvery flower (tetraploid) 2	2.796
	CNS0095612	Silvery flower (tetraploid) 3	5.227
	CNS0095613	Golden flower (tetraploid) 1	2.881
	CNS0095614	Golden flower (tetraploid) 2	1.275
	CNS0095615	Golden flower (tetraploid) 3	3.792
CRA001975	CRR073297	Stem 1	29.976
	CRR073298	Stem 2	28.673
	CRR073299	Stem 3	30.682
	CRR073300	Leaf 1	42.740
	CRR073301	Leaf 2	37.276
	CRR073302	Leaf 3	31.091
	CRR073303	Juvenile bud 1	34.958
	CRR073304	Juvenile bud 2	51.290
	CRR073305	Juvenile bud 3	6.670
	CRR073306	Third green 1	11.836
	CRR073307	Third green 2	12.171
	CRR073308	Third green 3	12.482
	CRR073309	Second white 1	8.489
	CRR073310	Second white 2	6.454
	CRR073311	Second white 3	8.787
	CRR073312	Silver flowering 1	20.757
	CRR073313	Silver flowering 2	20.641
	CRR073314	Silver flowering 3	11.344
	CRR073315	Gold flowering 1	5.670
	CRR073316	Gold flowering 2	2.997
	CRR073317	Gold flowering 3	6.003
	CRR073318	Tawny withering 1	7.349
	CRR073319	Tawny withering 2	4.756
	CRR073320	Tawny withering 3	10.551