Gene detail

Detail information of GWHGAAZE025415

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO55620.1	6.28771E-68	hypothetical protein CISIN_1g037913mg [Citrus sinensis]
COG	YP_003299106.1	0.000002	putative signal transduction protein with EFhand domain
Swissprot	tr\|Q9SRE6\|CML38_ARATH	2E-42	Calcium-binding protein CML38
trEMBL	tr\|A0A067EP25\|A0A067EP25_CITSI	2E-68	Uncharacterized protein {ECO:0000313\|EMBL:KDO55620.1}
TAIR10	AT1G76650.3	1E-31	calmodulin-like 38

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	60899422	60899853	-
GWHAAZE00000007	mRNA	60899422	60899853	-
GWHAAZE00000007	exon	60899422	60899853	-
GWHAAZE00000007	CDS	60899422	60899853	-

Transcript Sequence
>GWHTAAZE025449 ATGGTTATGGATAACAAACACCAACAATATGAACGCGTATTTAATCACTTTGACCAGAACAAAGACGGAAAGTTATCCCCGCCGGAGCTTCAACAATGTGTGGAGTCCATTGGTGGCGAGCTATCGATAGAGGAGGCAGAGGCGGCGGTTGAAGTTATGGACTCAGACGGGGATGGAATGCTTTGTTTACAGGATTTTGTAAAGGTGGTGGAAAATGTGGAAGAAGAAGAGAGAGTGAAAGATTTGAGAGAGGCTTTTAAGATGTATGAAATGGACGGTTGTGATTTCATCACGCCCAAGAGTTTGAAGAGGATGCTTAGTAGATTAGGCTTGTCCAAGAGCATGGATGAATGTGAGTTGATGATAGCTAGATTTGATCTTAATGGAGATGGGGTCCTCCATTTTGACGAGTTTGTGGTTATGATGTGGTGA

Network for GWHGAAZE025415

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	9	70	1.40E-09
PF13833.7	EF-hand_8	95	142	6.80E-11

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.840
	SRR3591706	second leaf	0.484
	SRR3591707	mature leaf	0.354
	SRR3591708	Shoot apex	0.188
	SRR3591709	Stem	4.762
	SRR3591710	White floral bud	1.171
	SRR3591711	White flower	4.541
	SRR3591712	Green floral bud	0.699
	SRR3591713	Yellow flower	6.701
SRP173429	SRR8316895	Juvenile bud stage	0.905
	SRR8316896	Juvenile bud stage	0.761
	SRR8316897	Juvenile bud stage	0.675
	SRR8316894	Third green stage	0.208
	SRR8316900	Third green stage	0.974
	SRR8316901	Third green stage	0.541
	SRR8316898	Complete white stage	0.143
	SRR8316899	Complete white stage	3.224
	SRR8316903	Complete white stage	1.184
	SRR8316902	Silver flowering stage	0.420
	SRR8316904	Silver flowering stage	1.049
	SRR8316905	Silver flowering stage	0.710
	SRR8316906	Gold flowering stage	4.283
	SRR8316907	Gold flowering stage	2.201
	SRR8316908	Gold flowering stage	8.072
SRP132670	SRR6706286	Control	5.606
	SRR6706287	Light intensity 50%	5.021
	SRR6706288	Light intensity 20%	1.709
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.850
	CNS0095593	Slightly white alabastrum(diploid) 2	4.126
	CNS0095594	Slightly white alabastrum(diploid) 3	4.712
	CNS0095595	Whole white alabastrum(diploid) 2	1.254
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	1.284
	CNS0095598	Silvery flower (diploied) 1	6.564
	CNS0095599	Silvery flower (diploied) 2	4.334
	CNS0095600	Silvery flower (diploied) 3	1.867
	CNS0095601	Golden flower (diploid) 1	14.309
	CNS0095602	Golden flower (diploid) 2	2.305
	CNS0095603	Golden flower (diploid) 3	3.050
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.209
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.185
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.022
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.155
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.583
	CNS0095611	Silvery flower (tetraploid) 2	0.114
	CNS0095612	Silvery flower (tetraploid) 3	1.327
	CNS0095613	Golden flower (tetraploid) 1	1.622
	CNS0095614	Golden flower (tetraploid) 2	1.018
	CNS0095615	Golden flower (tetraploid) 3	0.217
CRA001975	CRR073297	Stem 1	0.589
	CRR073298	Stem 2	0.491
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.439
	CRR073301	Leaf 2	2.300
	CRR073302	Leaf 3	0.870
	CRR073303	Juvenile bud 1	0.459
	CRR073304	Juvenile bud 2	0.266
	CRR073305	Juvenile bud 3	0.196
	CRR073306	Third green 1	0.379
	CRR073307	Third green 2	0.066
	CRR073308	Third green 3	0.414
	CRR073309	Second white 1	0.616
	CRR073310	Second white 2	1.508
	CRR073311	Second white 3	0.247
	CRR073312	Silver flowering 1	0.769
	CRR073313	Silver flowering 2	2.343
	CRR073314	Silver flowering 3	1.861
	CRR073315	Gold flowering 1	1.650
	CRR073316	Gold flowering 2	3.306
	CRR073317	Gold flowering 3	6.750
	CRR073318	Tawny withering 1	17.707
	CRR073319	Tawny withering 2	48.867
	CRR073320	Tawny withering 3	8.119