Gene detail

Detail information of GWHGAAZE025414

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010111596.1	1.23761E-28	Calcium-binding protein CML38 [Morus notabilis]
Swissprot	tr\|Q8RYK0\|CML31_ORYSJ	3E-22	Probable calcium-binding protein CML31
trEMBL	tr\|W9SWS7\|W9SWS7_9ROSA	5E-29	Calcium-binding protein CML38 {ECO:0000313\|EMBL:EXC31341.1}
TAIR10	AT3G01830.1	3E-17	Calcium-binding EF-hand family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	60896965	60897454	-
GWHAAZE00000007	mRNA	60896965	60897454	-
GWHAAZE00000007	exon	60896965	60897217	-
GWHAAZE00000007	exon	60897432	60897454	-
GWHAAZE00000007	CDS	60897432	60897454	-
GWHAAZE00000007	CDS	60896965	60897217	-

Transcript Sequence
>GWHTAAZE025448 ATGAAGGGCCACTGGTTGCCGTTGGGGGGTGAGTTTCAAACTTTTGAAATTTGGGGTGAATATAAAGTTTTAGTGAGAGTGAAAGATTTGAGAGAGGCTTTTAAGATGTATGAAATGGACGGTTGTGATTTCATCACGCCCAAGAGTTTGAAAAGGATGCTTAGTAGATTAGGCGTGTCCAAGAGCATGGATGAATGTGAGTTGATGATAGCTAGATTTGATCTTAATGGAGATGGGGTCCTCCATTTTGACGAGTTTGTGGTTATGATGTGGTGA

Network for GWHGAAZE025414

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13499.7	EF-hand_7	29	90	8.30E-12

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K13448	CML	Plant-pathogen interaction	map04626

Gene Ontology

GO term	Ontology	Name
GO:0005509	molecular_function	calcium ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	1.354
	SRR3591710	White floral bud	0.240
	SRR3591711	White flower	1.397
	SRR3591712	Green floral bud	0.000
	SRR3591713	Yellow flower	0.878
SRP173429	SRR8316895	Juvenile bud stage	0.000
	SRR8316896	Juvenile bud stage	0.121
	SRR8316897	Juvenile bud stage	0.000
	SRR8316894	Third green stage	0.000
	SRR8316900	Third green stage	0.000
	SRR8316901	Third green stage	0.064
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.493
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.118
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.219
	SRR8316907	Gold flowering stage	0.335
	SRR8316908	Gold flowering stage	0.632
SRP132670	SRR6706286	Control	0.023
	SRR6706287	Light intensity 50%	0.150
	SRR6706288	Light intensity 20%	0.034
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.348
	CNS0095593	Slightly white alabastrum(diploid) 2	0.356
	CNS0095594	Slightly white alabastrum(diploid) 3	0.552
	CNS0095595	Whole white alabastrum(diploid) 2	0.255
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.425
	CNS0095598	Silvery flower (diploied) 1	1.029
	CNS0095599	Silvery flower (diploied) 2	0.673
	CNS0095600	Silvery flower (diploied) 3	0.074
	CNS0095601	Golden flower (diploid) 1	0.269
	CNS0095602	Golden flower (diploid) 2	0.268
	CNS0095603	Golden flower (diploid) 3	0.270
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.000
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.164
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.029
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.484
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.714
	CRR073318	Tawny withering 1	0.675
	CRR073319	Tawny withering 2	2.249
	CRR073320	Tawny withering 3	0.869