Gene detail

Detail information of GWHGAAZE025384

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_009598927.1	2.4787E-108	PREDICTED: succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2, mitochondrial-like [Nicotiana tomentosiformis]
COG	YP_742174.1	5E-75	succinate dehydrogenase iron-sulfur subunit
Swissprot	tr\|Q8LB02\|SDHB2_ARATH	2E-107	Succinate dehydrogenase [ubiquinone] iron-sulfur subunit 2, mitochondrial (Precursor)
trEMBL	tr\|A0A0A0LBZ3\|A0A0A0LBZ3_CUCSA	2E-108	Uncharacterized protein {ECO:0000313\|EMBL:KGN58222.1}
TAIR10	AT5G40650.1	8E-86	succinate dehydrogenase 2-2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	60470420	60472943	+
GWHAAZE00000007	mRNA	60470420	60472943	+
GWHAAZE00000007	exon	60470420	60470751	+
GWHAAZE00000007	exon	60472769	60472943	+
GWHAAZE00000007	CDS	60470420	60470751	+
GWHAAZE00000007	CDS	60472769	60472943	+

Transcript Sequence
>GWHTAAZE025418 ATGAACATTGATGGATGTAATGGACTTGCTTGTTTGACTAAGATTGAATCGGGAGGTGATTCCACTATTACCCCTTTGCCTCATATGTTTGTGATTAAGGATCTGGTTGTGGATATGACCAATTTTTATAATCAGTATAAGAGTATTGAGCCTTGGTTGAAGAGGAAGACTAAAGGTGAAGGAAAGGAGATTTTGCAGAGTAAGAAGGATAGGGCGAAATTGGATGGTATGTATGAGTGTATTTTGTGTGCGTGTTGTAGTACTTCTTGCCCCAGTTATTGGTGGAACCCTGAGTCTTATCTTGGACCTGCCGCTCTCCTTCACGCCAATCGATGGATTATGGACAGCCGTGATGAATACACTAAAGAGCGACTGGATGCAATATGTGACGAGTTCAAGTTATATCGATGCCACACTATTTTGAATTGTGCTCGAGCCTGCCCCAAAGGACTCAACCCTGGCAAACAAATCAACAACATTAAGAGGCTTCAGCTTTCATCTATTTAA

Network for GWHGAAZE025384

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF13085.7	Fer2_3	1	44	8.50E-08
PF13534.7	Fer4_17	79	152	1.80E-08

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00235	SDHB, SDH2	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Microbial metabolism in diverse environments	map01120
		Carbon metabolism	map01200
		Citrate cycle	map00020
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0006099	biological_process	tricarboxylic acid cycle
GO:0055114	biological_process	oxidation-reduction process
GO:0009055	molecular_function	electron transfer activity
GO:0051536	molecular_function	iron-sulfur cluster binding
GO:0016491	molecular_function	oxidoreductase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	144.283
	SRR3591706	second leaf	67.477
	SRR3591707	mature leaf	60.805
	SRR3591708	Shoot apex	115.491
	SRR3591709	Stem	123.206
	SRR3591710	White floral bud	175.488
	SRR3591711	White flower	184.801
	SRR3591712	Green floral bud	228.875
	SRR3591713	Yellow flower	164.833
SRP173429	SRR8316895	Juvenile bud stage	102.468
	SRR8316896	Juvenile bud stage	157.427
	SRR8316897	Juvenile bud stage	75.654
	SRR8316894	Third green stage	60.870
	SRR8316900	Third green stage	248.064
	SRR8316901	Third green stage	245.395
	SRR8316898	Complete white stage	99.791
	SRR8316899	Complete white stage	190.526
	SRR8316903	Complete white stage	134.574
	SRR8316902	Silver flowering stage	114.755
	SRR8316904	Silver flowering stage	133.167
	SRR8316905	Silver flowering stage	61.776
	SRR8316906	Gold flowering stage	184.439
	SRR8316907	Gold flowering stage	214.594
	SRR8316908	Gold flowering stage	208.982
SRP132670	SRR6706286	Control	169.872
	SRR6706287	Light intensity 50%	170.351
	SRR6706288	Light intensity 20%	172.610
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	166.782
	CNS0095593	Slightly white alabastrum(diploid) 2	160.832
	CNS0095594	Slightly white alabastrum(diploid) 3	160.190
	CNS0095595	Whole white alabastrum(diploid) 2	191.343
	CNS0095596	Whole white alabastrum(diploid) 3	227.779
	CNS0095597	Whole white alabastrum(diploid) 4	167.665
	CNS0095598	Silvery flower (diploied) 1	103.703
	CNS0095599	Silvery flower (diploied) 2	111.912
	CNS0095600	Silvery flower (diploied) 3	185.227
	CNS0095601	Golden flower (diploid) 1	113.046
	CNS0095602	Golden flower (diploid) 2	153.619
	CNS0095603	Golden flower (diploid) 3	146.395
	CNS0095604	Slightly white alabastrum(tetraploid) 1	199.997
	CNS0095605	Slightly white alabastrum(tetraploid) 2	194.469
	CNS0095606	Slightly white alabastrum(tetraploid) 3	176.736
	CNS0095607	Whole white alabastrum(tetraploid) 1	205.057
	CNS0095608	Whole white alabastrum(tetraploid) 2	223.403
	CNS0095609	Whole white alabastrum(tetraploid) 3	233.376
	CNS0095610	Silvery flower (tetraploid) 1	207.709
	CNS0095611	Silvery flower (tetraploid) 2	173.425
	CNS0095612	Silvery flower (tetraploid) 3	223.150
	CNS0095613	Golden flower (tetraploid) 1	127.976
	CNS0095614	Golden flower (tetraploid) 2	169.063
	CNS0095615	Golden flower (tetraploid) 3	108.102
CRA001975	CRR073297	Stem 1	138.210
	CRR073298	Stem 2	138.664
	CRR073299	Stem 3	139.993
	CRR073300	Leaf 1	172.020
	CRR073301	Leaf 2	176.416
	CRR073302	Leaf 3	165.522
	CRR073303	Juvenile bud 1	234.964
	CRR073304	Juvenile bud 2	246.702
	CRR073305	Juvenile bud 3	218.859
	CRR073306	Third green 1	255.864
	CRR073307	Third green 2	220.253
	CRR073308	Third green 3	209.790
	CRR073309	Second white 1	334.945
	CRR073310	Second white 2	189.217
	CRR073311	Second white 3	183.479
	CRR073312	Silver flowering 1	164.385
	CRR073313	Silver flowering 2	173.440
	CRR073314	Silver flowering 3	141.044
	CRR073315	Gold flowering 1	55.830
	CRR073316	Gold flowering 2	74.123
	CRR073317	Gold flowering 3	72.342
	CRR073318	Tawny withering 1	160.498
	CRR073319	Tawny withering 2	100.187
	CRR073320	Tawny withering 3	141.595