Gene detail

Detail information of GWHGAAZE025367

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KHG12489.1	1.115E-117	Ras-related RABB1b -like protein [Gossypium arboreum]
COG	YP_008431664.1	2E-25	hypothetical protein N186_01315
Swissprot	tr\|Q38922\|RAB1B_ARATH	2E-115	Ras-related protein RABB1b
trEMBL	tr\|A0A068UM16\|A0A068UM16_COFCA	6E-118	Coffea canephora DH200=94 genomic scaffold, scaffold_38 {ECO:0000313\|EMBL:CDP09506.1}
TAIR10	AT4G35860.1	2E-91	GTP-binding 2

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	60257704	60263129	-
GWHAAZE00000007	mRNA	60257704	60263129	-
GWHAAZE00000007	exon	60263112	60263129	-
GWHAAZE00000007	exon	60262108	60262275	-
GWHAAZE00000007	exon	60258474	60258556	-
GWHAAZE00000007	exon	60257876	60258080	-
GWHAAZE00000007	exon	60257704	60257793	-
GWHAAZE00000007	CDS	60263112	60263129	-
GWHAAZE00000007	CDS	60262108	60262275	-
GWHAAZE00000007	CDS	60258474	60258556	-
GWHAAZE00000007	CDS	60257876	60258080	-
GWHAAZE00000007	CDS	60257704	60257793	-

Transcript Sequence
>GWHTAAZE025401 ATGACGCCCGATATTAAGGGTTTTTATGGGAGAGTTGAACTTGCAGGTGTGGGAAAATCATGTTTATTGTTGCAATTCACGGACAAGAGGTTTCAGCCTGTACATGATCTCACAATTGGAGTTGAGTTCGGTGCTCGTATGGTCACCATCGATGGCCGCCCCATTAAGCTTCAGATTTGGGATACTGCTGGGCAAGAATCGTTCAGATCGATCACCCGATCATATTACAGAGGAGCAGCAGGGGCACTTCTCGTTTATGATATAACAAGGAGAGAGACATTTAATCATCTAGCAAGCTGGCTTGAAGATGCTCGGCAACATGCTAACCCAAACATGACAATAATGCTCATAGGGAACAAGAGTGATCTTTCCCACCGAAGGGCTGTCAGCAAAGAGGAAGGAGAGCAATTTGCAAAGGAAAATGGCCTTTTATTCTTGGAGGCATCTGCAAGAACAGCCCAAAATGTCGAGGAGGCCTTTATAAGGACTGCAGCAAAGATACTGCAGAAAATCAAGGAAGGCGTGTTTGATGTATCCAATGAGGTAAGTGCTCTCAGTTATTGA

Network for GWHGAAZE025367

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00071.23	Ras	15	168	2.80E-57

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K07877	RAB2A	AMPK signaling pathway	map04152

Gene Ontology

GO term	Ontology	Name
GO:0003924	molecular_function	GTPase activity
GO:0005525	molecular_function	GTP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	22.957
	SRR3591706	second leaf	15.442
	SRR3591707	mature leaf	14.962
	SRR3591708	Shoot apex	23.128
	SRR3591709	Stem	37.446
	SRR3591710	White floral bud	29.747
	SRR3591711	White flower	37.649
	SRR3591712	Green floral bud	17.318
	SRR3591713	Yellow flower	48.505
SRP173429	SRR8316895	Juvenile bud stage	10.686
	SRR8316896	Juvenile bud stage	13.435
	SRR8316897	Juvenile bud stage	6.677
	SRR8316894	Third green stage	5.923
	SRR8316900	Third green stage	15.567
	SRR8316901	Third green stage	16.695
	SRR8316898	Complete white stage	12.859
	SRR8316899	Complete white stage	34.042
	SRR8316903	Complete white stage	22.026
	SRR8316902	Silver flowering stage	13.176
	SRR8316904	Silver flowering stage	18.189
	SRR8316905	Silver flowering stage	9.604
	SRR8316906	Gold flowering stage	37.326
	SRR8316907	Gold flowering stage	29.492
	SRR8316908	Gold flowering stage	29.075
SRP132670	SRR6706286	Control	28.046
	SRR6706287	Light intensity 50%	25.766
	SRR6706288	Light intensity 20%	27.319
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	10.888
	CNS0095593	Slightly white alabastrum(diploid) 2	16.689
	CNS0095594	Slightly white alabastrum(diploid) 3	11.757
	CNS0095595	Whole white alabastrum(diploid) 2	13.603
	CNS0095596	Whole white alabastrum(diploid) 3	10.028
	CNS0095597	Whole white alabastrum(diploid) 4	13.146
	CNS0095598	Silvery flower (diploied) 1	25.503
	CNS0095599	Silvery flower (diploied) 2	16.111
	CNS0095600	Silvery flower (diploied) 3	26.108
	CNS0095601	Golden flower (diploid) 1	24.952
	CNS0095602	Golden flower (diploid) 2	33.083
	CNS0095603	Golden flower (diploid) 3	30.380
	CNS0095604	Slightly white alabastrum(tetraploid) 1	17.765
	CNS0095605	Slightly white alabastrum(tetraploid) 2	17.775
	CNS0095606	Slightly white alabastrum(tetraploid) 3	27.992
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.740
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.982
	CNS0095609	Whole white alabastrum(tetraploid) 3	15.019
	CNS0095610	Silvery flower (tetraploid) 1	46.913
	CNS0095611	Silvery flower (tetraploid) 2	48.295
	CNS0095612	Silvery flower (tetraploid) 3	30.365
	CNS0095613	Golden flower (tetraploid) 1	34.066
	CNS0095614	Golden flower (tetraploid) 2	38.975
	CNS0095615	Golden flower (tetraploid) 3	46.030
CRA001975	CRR073297	Stem 1	18.971
	CRR073298	Stem 2	14.684
	CRR073299	Stem 3	19.378
	CRR073300	Leaf 1	17.701
	CRR073301	Leaf 2	19.166
	CRR073302	Leaf 3	15.709
	CRR073303	Juvenile bud 1	22.651
	CRR073304	Juvenile bud 2	16.160
	CRR073305	Juvenile bud 3	20.862
	CRR073306	Third green 1	6.614
	CRR073307	Third green 2	14.711
	CRR073308	Third green 3	10.612
	CRR073309	Second white 1	9.733
	CRR073310	Second white 2	11.893
	CRR073311	Second white 3	11.303
	CRR073312	Silver flowering 1	5.881
	CRR073313	Silver flowering 2	9.474
	CRR073314	Silver flowering 3	6.859
	CRR073315	Gold flowering 1	24.280
	CRR073316	Gold flowering 2	24.367
	CRR073317	Gold flowering 3	16.841
	CRR073318	Tawny withering 1	16.021
	CRR073319	Tawny withering 2	15.147
	CRR073320	Tawny withering 3	17.688