Gene detail

Detail information of GWHGAAZE025221

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP16348.1	1.8619E-105	unnamed protein product [Coffea canephora]
COG	YP_004781726.1	1E-28	ribosomal-protein-alanine acetyltransferase
trEMBL	tr\|A0A068V8V0\|A0A068V8V0_COFCA	7E-106	Coffea canephora DH200=94 genomic scaffold, scaffold_122 {ECO:0000313\|EMBL:CDP16348.1}
TAIR10	AT5G13780.1	1E-75	Acyl-CoA N-acyltransferases (NAT) superfamily protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	57659226	57660831	+
GWHAAZE00000007	mRNA	57659226	57660831	+
GWHAAZE00000007	exon	57659226	57659610	+
GWHAAZE00000007	exon	57660298	57660330	+
GWHAAZE00000007	exon	57660623	57660831	+
GWHAAZE00000007	CDS	57659226	57659610	+
GWHAAZE00000007	CDS	57660298	57660330	+
GWHAAZE00000007	CDS	57660623	57660831	+

Transcript Sequence
>GWHTAAZE025255 ATGGTGTGCATACGCAAAGCCACCATAGATGACCTACTCCAAATGCAAGCCTGCAACCTCTTCTGCCTGCCGGAAAACTACCAGATGAAATACTATTTCTACCACATCCTCTCTTGGCCCCAGCTCCTCTACGTGGCCGAGGACTACAATGGAAAGATCGTCGGCTACGTACTGGCTAAGATGGAGGAGGAGAGCTCTACCGCCGAGTGCCACGGTCACATCACCTCCCTCGCCGTGCTTCGTACTCACCGGAAGCTGGGGCTGGCCACCAAGCTCATGACGGCGGCTCAGAATGCTATGGAGCTGGTGTTTGGGGCTGATCATGTTGCGCTTCACGTCAGGAAGAGTAACCGGGCTGCGTTTAATCTCTACACGGAGACTTTAGTAGTTGAAGAACCAGAGGTCAACACATACAGAGGGTACAAGATTCATGATGTGGAAGCGAAGTATTATGCTGATGGGGAGGATGCTTATGATATGAGGAAGCAATTGATGGGGAAGAGGGATGGGATTCATAATCATGGTCATAGTCATAGTCATCATCATCATCATCATGGCGGAGGGTGTTGCTCCGGCGAGGTGAAGTCCAGCGAGGTTAAAGCAGAGTCAACCACGGGGTCGGCTTAG

Network for GWHGAAZE025221

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00583.26	Acetyltransf_1	38	126	8.30E-14

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	GNAT

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0008080	molecular_function	N-acetyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	58.622
	SRR3591706	second leaf	33.649
	SRR3591707	mature leaf	21.471
	SRR3591708	Shoot apex	82.137
	SRR3591709	Stem	46.784
	SRR3591710	White floral bud	47.891
	SRR3591711	White flower	54.364
	SRR3591712	Green floral bud	62.024
	SRR3591713	Yellow flower	51.908
SRP173429	SRR8316895	Juvenile bud stage	38.627
	SRR8316896	Juvenile bud stage	54.595
	SRR8316897	Juvenile bud stage	26.028
	SRR8316894	Third green stage	23.300
	SRR8316900	Third green stage	64.799
	SRR8316901	Third green stage	64.870
	SRR8316898	Complete white stage	21.651
	SRR8316899	Complete white stage	66.477
	SRR8316903	Complete white stage	27.143
	SRR8316902	Silver flowering stage	18.329
	SRR8316904	Silver flowering stage	19.806
	SRR8316905	Silver flowering stage	12.388
	SRR8316906	Gold flowering stage	36.167
	SRR8316907	Gold flowering stage	38.579
	SRR8316908	Gold flowering stage	48.855
SRP132670	SRR6706286	Control	80.204
	SRR6706287	Light intensity 50%	80.042
	SRR6706288	Light intensity 20%	86.813
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	68.114
	CNS0095593	Slightly white alabastrum(diploid) 2	69.026
	CNS0095594	Slightly white alabastrum(diploid) 3	64.478
	CNS0095595	Whole white alabastrum(diploid) 2	52.220
	CNS0095596	Whole white alabastrum(diploid) 3	57.798
	CNS0095597	Whole white alabastrum(diploid) 4	42.143
	CNS0095598	Silvery flower (diploied) 1	45.825
	CNS0095599	Silvery flower (diploied) 2	40.835
	CNS0095600	Silvery flower (diploied) 3	41.617
	CNS0095601	Golden flower (diploid) 1	38.430
	CNS0095602	Golden flower (diploid) 2	41.757
	CNS0095603	Golden flower (diploid) 3	38.568
	CNS0095604	Slightly white alabastrum(tetraploid) 1	51.845
	CNS0095605	Slightly white alabastrum(tetraploid) 2	56.048
	CNS0095606	Slightly white alabastrum(tetraploid) 3	61.633
	CNS0095607	Whole white alabastrum(tetraploid) 1	37.592
	CNS0095608	Whole white alabastrum(tetraploid) 2	26.844
	CNS0095609	Whole white alabastrum(tetraploid) 3	55.524
	CNS0095610	Silvery flower (tetraploid) 1	30.393
	CNS0095611	Silvery flower (tetraploid) 2	35.362
	CNS0095612	Silvery flower (tetraploid) 3	43.197
	CNS0095613	Golden flower (tetraploid) 1	28.567
	CNS0095614	Golden flower (tetraploid) 2	30.669
	CNS0095615	Golden flower (tetraploid) 3	28.224
CRA001975	CRR073297	Stem 1	49.852
	CRR073298	Stem 2	43.413
	CRR073299	Stem 3	54.606
	CRR073300	Leaf 1	43.041
	CRR073301	Leaf 2	47.273
	CRR073302	Leaf 3	67.889
	CRR073303	Juvenile bud 1	51.760
	CRR073304	Juvenile bud 2	46.217
	CRR073305	Juvenile bud 3	43.719
	CRR073306	Third green 1	27.761
	CRR073307	Third green 2	29.224
	CRR073308	Third green 3	28.358
	CRR073309	Second white 1	25.691
	CRR073310	Second white 2	26.285
	CRR073311	Second white 3	18.174
	CRR073312	Silver flowering 1	19.373
	CRR073313	Silver flowering 2	30.782
	CRR073314	Silver flowering 3	15.433
	CRR073315	Gold flowering 1	22.932
	CRR073316	Gold flowering 2	27.266
	CRR073317	Gold flowering 3	22.052
	CRR073318	Tawny withering 1	55.349
	CRR073319	Tawny withering 2	52.678
	CRR073320	Tawny withering 3	55.338