Gene detail

Detail information of GWHGAAZE024595

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP10226.1	1.9972E-92	unnamed protein product [Coffea canephora]
COG	YP_007206260.1	6E-14	WD40 repeat-containing protein
Swissprot	tr\|C0LGK9\|Y2242_ARATH	2E-85	Probable LRR receptor-like serine/threonine-protein kinase At2g24230 (Precursor)
trEMBL	tr\|A0A068UP96\|A0A068UP96_COFCA	7E-93	Coffea canephora DH200=94 genomic scaffold, scaffold_43 {ECO:0000313\|EMBL:CDP10226.1}
TAIR10	AT2G24230.1	2E-73	Leucine-rich repeat protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	45815025	45815540	+
GWHAAZE00000007	mRNA	45815025	45815540	+
GWHAAZE00000007	exon	45815025	45815540	+
GWHAAZE00000007	CDS	45815025	45815540	+

Transcript Sequence
>GWHTAAZE024629 CTGCACCACGGGTGCTCGCCGCCTATTATCCACAGAGATGTTAAAGCTAGTAGCGTTTATCTTGATTTGAACTTAGAACCAAGATTATCCGATTTTGGGCTAGCTAAGATTTTTGGGAATGATCTTGAGGATGAAATCGCTCGAGGCTCAAAAGGGTACGTCCCGCCAGAGTTTTGCACGCCAGCAAATGGGTCCCCGACAGTCGTGACACCGAAATCCGACGTCTATGCATTTGGGGTTGTACTTTTGGAGCTAATTACGGGTAAAAAGCCAGTTGAGGACGAGTATCCAGAGGAGAAAGAAGGGAGTTTGGTGAGTTGGGTGAGGGGACTAGTGAGGAAGAGCCAAGGGTTGAGAGCCGTTGATCCAAAAATCCGAGGGACGGGATCGGAGGATCAAATGGTGGAGGCTTTGAAGATTGGGTACTTATGTACGGCCGATCTACCGACGAAGCGGCCGAGTATGCAGCAGGTAGTTGGACTTTTGAAGGATATTGAACCGGTTACAAATCAGTGA

Network for GWHGAAZE024595

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	8	159	3.80E-18

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-VII-2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	26.264
	SRR3591706	second leaf	10.648
	SRR3591707	mature leaf	3.907
	SRR3591708	Shoot apex	20.425
	SRR3591709	Stem	26.804
	SRR3591710	White floral bud	5.328
	SRR3591711	White flower	4.577
	SRR3591712	Green floral bud	9.565
	SRR3591713	Yellow flower	1.628
SRP173429	SRR8316895	Juvenile bud stage	3.796
	SRR8316896	Juvenile bud stage	2.865
	SRR8316897	Juvenile bud stage	1.131
	SRR8316894	Third green stage	0.691
	SRR8316900	Third green stage	1.680
	SRR8316901	Third green stage	2.913
	SRR8316898	Complete white stage	0.748
	SRR8316899	Complete white stage	2.147
	SRR8316903	Complete white stage	1.339
	SRR8316902	Silver flowering stage	0.734
	SRR8316904	Silver flowering stage	0.412
	SRR8316905	Silver flowering stage	0.658
	SRR8316906	Gold flowering stage	1.137
	SRR8316907	Gold flowering stage	2.202
	SRR8316908	Gold flowering stage	2.644
SRP132670	SRR6706286	Control	1.680
	SRR6706287	Light intensity 50%	2.720
	SRR6706288	Light intensity 20%	1.976
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.876
	CNS0095593	Slightly white alabastrum(diploid) 2	2.188
	CNS0095594	Slightly white alabastrum(diploid) 3	4.420
	CNS0095595	Whole white alabastrum(diploid) 2	3.071
	CNS0095596	Whole white alabastrum(diploid) 3	1.549
	CNS0095597	Whole white alabastrum(diploid) 4	1.628
	CNS0095598	Silvery flower (diploied) 1	5.181
	CNS0095599	Silvery flower (diploied) 2	2.025
	CNS0095600	Silvery flower (diploied) 3	1.585
	CNS0095601	Golden flower (diploid) 1	3.002
	CNS0095602	Golden flower (diploid) 2	1.511
	CNS0095603	Golden flower (diploid) 3	1.428
	CNS0095604	Slightly white alabastrum(tetraploid) 1	6.035
	CNS0095605	Slightly white alabastrum(tetraploid) 2	3.376
	CNS0095606	Slightly white alabastrum(tetraploid) 3	6.101
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.650
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.217
	CNS0095609	Whole white alabastrum(tetraploid) 3	3.355
	CNS0095610	Silvery flower (tetraploid) 1	1.734
	CNS0095611	Silvery flower (tetraploid) 2	0.802
	CNS0095612	Silvery flower (tetraploid) 3	0.701
	CNS0095613	Golden flower (tetraploid) 1	0.184
	CNS0095614	Golden flower (tetraploid) 2	2.410
	CNS0095615	Golden flower (tetraploid) 3	0.398
CRA001975	CRR073297	Stem 1	9.421
	CRR073298	Stem 2	7.169
	CRR073299	Stem 3	15.733
	CRR073300	Leaf 1	6.034
	CRR073301	Leaf 2	5.723
	CRR073302	Leaf 3	2.483
	CRR073303	Juvenile bud 1	3.690
	CRR073304	Juvenile bud 2	5.048
	CRR073305	Juvenile bud 3	3.011
	CRR073306	Third green 1	9.337
	CRR073307	Third green 2	3.688
	CRR073308	Third green 3	7.733
	CRR073309	Second white 1	1.904
	CRR073310	Second white 2	2.225
	CRR073311	Second white 3	1.753
	CRR073312	Silver flowering 1	0.291
	CRR073313	Silver flowering 2	0.390
	CRR073314	Silver flowering 3	0.640
	CRR073315	Gold flowering 1	1.103
	CRR073316	Gold flowering 2	1.100
	CRR073317	Gold flowering 3	2.132
	CRR073318	Tawny withering 1	42.605
	CRR073319	Tawny withering 2	21.310
	CRR073320	Tawny withering 3	42.109