Gene detail

Detail information of GWHGAAZE024522

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_010030844.1	1.6255E-157	PREDICTED: probable LRR receptor-like serine/threonine-protein kinase At4g08850 [Eucalyptus grandis]
COG	YP_226417.1	1E-26	serine/threonine protein kinase
Swissprot	tr\|Q8VZG8\|Y4885_ARATH	2E-106	Probable LRR receptor-like serine/threonine-protein kinase At4g08850 (Precursor)
trEMBL	tr\|A0A067D9C8\|A0A067D9C8_CITSI	1E-157	Uncharacterized protein {ECO:0000313\|EMBL:KDO39604.1}
TAIR10	AT4G08850.1	3E-88	Leucine-rich repeat receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	44207879	44209210	-
GWHAAZE00000007	mRNA	44207879	44209210	-
GWHAAZE00000007	exon	44207879	44208249	-
GWHAAZE00000007	exon	44208463	44209210	-
GWHAAZE00000007	CDS	44208463	44209210	-
GWHAAZE00000007	CDS	44207879	44208249	-

Transcript Sequence
>GWHTAAZE024556 ATGTCTTCAAAAGACACTACGAACGCAGTCAAGCTTTTTTGCCTCATCGCTCTTCCTGCCGAAATTTCCATCGTTATCTTAATCGTTCTCCTAATTAGGTTCTTTTTCAGGCGCAAGGCTATAGAAGGTGGGAGCAAAGCAAGAGTAATGAAGCACGGAGATATGTGCTCCATATGGAATTATGATGGGACAATTGCGTACGAAGACATTATCAAATCAACAAATGACTTCGATATTAAATACTGCATTGGTACTGGCGGGTATGGCAGCGTCTACCGTGCTCTCCTACCTTGTGGCAAAGTTGTCGCCTTAAAGAAACTTGATCCATTTGAAGTCGAGGAGCCAGCTTTCAACCAGAGTTTCAAGAATGAGGCACAAGTTTTATCAAACATAAGACATAAAAACATTGTAAAGCTTTACGGGTTTTGTTTACACAATAGATGCATGTTCCTAGTTTATGAATACATGGAAAGAGGAAGCTTATTCTGCGCCCTAAGAGATGATACAGAGGCAGTTGAATTGGATTGGAGTAGAAGGGTGAACATTGTTAAAGGCATAGCACATGCTTTATCATACATGCATCGTGATTGTACTCCACCTATTGTTCATCGGGATATTTCAAGTAATAATATACTCTTAAACTCTAAACTGGAGGCATTTGTAGCCGACTTTGGTGCTGCTAGATTGTTATCTGCCGATTCGTCCAATCAAACTTTAATTGCAGGCACCTATGGATATATTGCTCCAGAACTTTCCTACACCATGGTAGTGACCGAAAAATGCGATGTTTATAGCTTTGGGGTGGTCGCATTTGAAATAATCATGGGAAAGCATCCAGGAGATCTTCTTTCATCATTAACTTCTCTGTCAACACAAAACCCAACAGTGAATGATGTCTTGGACCCACGGCTCTCACATCCAACAGATCCACTTGTTGAATGGGATATCGTTATGGTTCTGAGGTTGGCCTTTTCATGCTTATGTTCTAATCCTAAATCTCGGCCAACAATGGAAAGCGTGTCACAAGCATTGCTAGTACGCAGGATGCCACTACCCAAGCCTCTTCACTTGATTTCACTATTAGAGCTGTCGAGTCAGCAGAAATGTTTGATGAATTAA

Network for GWHGAAZE024522

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	81	342	1.40E-45

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-XI-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.168
	SRR3591706	second leaf	0.163
	SRR3591707	mature leaf	0.695
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	1.013
	SRR3591710	White floral bud	0.111
	SRR3591711	White flower	1.278
	SRR3591712	Green floral bud	0.194
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.474
	SRR8316896	Juvenile bud stage	0.910
	SRR8316897	Juvenile bud stage	0.192
	SRR8316894	Third green stage	0.831
	SRR8316900	Third green stage	1.044
	SRR8316901	Third green stage	1.662
	SRR8316898	Complete white stage	0.044
	SRR8316899	Complete white stage	0.899
	SRR8316903	Complete white stage	0.229
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.031
	SRR8316906	Gold flowering stage	0.061
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	2.034
	SRR6706287	Light intensity 50%	0.817
	SRR6706288	Light intensity 20%	0.657
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.308
	CNS0095593	Slightly white alabastrum(diploid) 2	0.557
	CNS0095594	Slightly white alabastrum(diploid) 3	1.163
	CNS0095595	Whole white alabastrum(diploid) 2	0.837
	CNS0095596	Whole white alabastrum(diploid) 3	0.762
	CNS0095597	Whole white alabastrum(diploid) 4	0.740
	CNS0095598	Silvery flower (diploied) 1	0.573
	CNS0095599	Silvery flower (diploied) 2	0.317
	CNS0095600	Silvery flower (diploied) 3	0.715
	CNS0095601	Golden flower (diploid) 1	0.597
	CNS0095602	Golden flower (diploid) 2	0.200
	CNS0095603	Golden flower (diploid) 3	0.235
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.284
	CRR073298	Stem 2	0.582
	CRR073299	Stem 3	0.058
	CRR073300	Leaf 1	0.360
	CRR073301	Leaf 2	0.894
	CRR073302	Leaf 3	0.633
	CRR073303	Juvenile bud 1	0.156
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.646
	CRR073306	Third green 1	0.072
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.463
	CRR073316	Gold flowering 2	0.770
	CRR073317	Gold flowering 3	0.226
	CRR073318	Tawny withering 1	0.236
	CRR073319	Tawny withering 2	0.924
	CRR073320	Tawny withering 3	0.000