Gene detail

Detail information of GWHGAAZE024455

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AES91581.2	7.66667E-23	beta-1,4-N-acetylglucosaminyltransferase-like protein [Medicago truncatula]
trEMBL	tr\|G7JE73\|G7JE73_MEDTR	3E-23	Beta-1,4-N-acetylglucosaminyltransferase-like protein {ECO:0000313\|EMBL:AES91581.2}
TAIR10	AT1G12990.1	2E-16	beta-1,4-N-acetylglucosaminyltransferase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	42731868	42732068	-
GWHAAZE00000007	mRNA	42731868	42732068	-
GWHAAZE00000007	exon	42731868	42732068	-
GWHAAZE00000007	CDS	42731868	42732068	-

Transcript Sequence
>GWHTAAZE024489 ATGTTACCTGAAGAGTATAGTTTCCAAGAATTGATCAAGAAGATGGGATCAATACCTAGTTCAACTTCAGCAGTTCATCTACCAGCGCACTTGATAGACAACGCGGACAAGTTCAAATTCCTTCTTCCTGGGGGTTGTTTACGCAAATCGCAACCGTTCCATCCTAGAAGATCAGCAGCTAGAATTAACTTGTTTAGATAA

Network for GWHGAAZE024455

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04724.14	Glyco_transf_17	1	49	8.40E-21

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00737	MGAT3	Metabolic pathways	map01100
K00737	MGAT3	N-Glycan biosynthesis	map00510

Gene Ontology

GO term	Ontology	Name
GO:0006487	biological_process	protein N-linked glycosylation
GO:0016020	cellular_component	membrane
GO:0003830	molecular_function	beta-1,4-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.649
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.070
	SRR3591708	Shoot apex	0.738
	SRR3591709	Stem	6.073
	SRR3591710	White floral bud	0.901
	SRR3591711	White flower	0.000
	SRR3591712	Green floral bud	0.709
	SRR3591713	Yellow flower	0.000
SRP173429	SRR8316895	Juvenile bud stage	0.132
	SRR8316896	Juvenile bud stage	1.261
	SRR8316897	Juvenile bud stage	1.640
	SRR8316894	Third green stage	0.488
	SRR8316900	Third green stage	4.757
	SRR8316901	Third green stage	4.194
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.937
	SRR6706287	Light intensity 50%	2.741
	SRR6706288	Light intensity 20%	2.011
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	5.091
	CNS0095593	Slightly white alabastrum(diploid) 2	1.971
	CNS0095594	Slightly white alabastrum(diploid) 3	7.208
	CNS0095595	Whole white alabastrum(diploid) 2	6.939
	CNS0095596	Whole white alabastrum(diploid) 3	10.410
	CNS0095597	Whole white alabastrum(diploid) 4	9.070
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.652
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.354
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.027
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.664
	CRR073298	Stem 2	0.729
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	1.426
	CRR073301	Leaf 2	1.965
	CRR073302	Leaf 3	0.528
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.607
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.039
	CRR073319	Tawny withering 2	0.257
	CRR073320	Tawny withering 3	4.096