Gene detail

Detail information of GWHGAAZE024416

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_002271789.1	3.5528E-49	PREDICTED: splicing factor 3B subunit 4 [Vitis vinifera]
COG	YP_003889850.1	0.00000001	RNP-1 like RNA-binding protein
Swissprot	tr\|Q9FXA2\|PABP8_ARATH	0.0000006	Polyadenylate-binding protein 8
trEMBL	tr\|D7SN08\|D7SN08_VITVI	1E-49	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI17037.3}
TAIR10	AT4G10110.1	4E-38	RNA-binding (RRM/RBD/RNP motifs) family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	41808003	41808609	+
GWHAAZE00000007	mRNA	41808003	41808609	+
GWHAAZE00000007	exon	41808003	41808227	+
GWHAAZE00000007	exon	41808568	41808609	+
GWHAAZE00000007	CDS	41808003	41808227	+
GWHAAZE00000007	CDS	41808568	41808609	+

Transcript Sequence
>GWHTAAZE024450 TCTTGTTACACAGGTAATCTGGATGAGAGAGTGAACGACAGGGTTTTGTACGATATTCTCATTCAAGCAGGGCGTGTGGTGGACTTATATATTCCTCGAGATAAGGAAACTGAACGACCAAAAGGTTTTGCCTTTGCTGAATATGAAACGGAGGAGATTGCCGACTATGCTGTCAGGCTTTTCTCTGGCCTTGTTACTCTCTACAACCGAACTTTGAAATTTGCGATATCTGGGCAAGATAAGCCCTCGCCGAACTTGCTCAATGCA

Network for GWHGAAZE024416

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00076.23	RRM_1	5	73	5.10E-14

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K12831	SF3B4, SAP49	Spliceosome	map03040

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	51.676
	SRR3591706	second leaf	25.015
	SRR3591707	mature leaf	53.062
	SRR3591708	Shoot apex	63.982
	SRR3591709	Stem	98.008
	SRR3591710	White floral bud	54.459
	SRR3591711	White flower	62.464
	SRR3591712	Green floral bud	60.927
	SRR3591713	Yellow flower	80.456
SRP173429	SRR8316895	Juvenile bud stage	22.253
	SRR8316896	Juvenile bud stage	40.673
	SRR8316897	Juvenile bud stage	17.893
	SRR8316894	Third green stage	15.337
	SRR8316900	Third green stage	65.896
	SRR8316901	Third green stage	52.136
	SRR8316898	Complete white stage	26.367
	SRR8316899	Complete white stage	47.893
	SRR8316903	Complete white stage	30.858
	SRR8316902	Silver flowering stage	29.974
	SRR8316904	Silver flowering stage	39.711
	SRR8316905	Silver flowering stage	18.887
	SRR8316906	Gold flowering stage	86.124
	SRR8316907	Gold flowering stage	94.247
	SRR8316908	Gold flowering stage	87.960
SRP132670	SRR6706286	Control	62.651
	SRR6706287	Light intensity 50%	74.629
	SRR6706288	Light intensity 20%	67.587
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	40.424
	CNS0095593	Slightly white alabastrum(diploid) 2	39.710
	CNS0095594	Slightly white alabastrum(diploid) 3	51.746
	CNS0095595	Whole white alabastrum(diploid) 2	48.381
	CNS0095596	Whole white alabastrum(diploid) 3	66.644
	CNS0095597	Whole white alabastrum(diploid) 4	41.056
	CNS0095598	Silvery flower (diploied) 1	30.663
	CNS0095599	Silvery flower (diploied) 2	29.322
	CNS0095600	Silvery flower (diploied) 3	57.990
	CNS0095601	Golden flower (diploid) 1	33.221
	CNS0095602	Golden flower (diploid) 2	60.866
	CNS0095603	Golden flower (diploid) 3	60.159
	CNS0095604	Slightly white alabastrum(tetraploid) 1	47.039
	CNS0095605	Slightly white alabastrum(tetraploid) 2	40.122
	CNS0095606	Slightly white alabastrum(tetraploid) 3	33.441
	CNS0095607	Whole white alabastrum(tetraploid) 1	55.723
	CNS0095608	Whole white alabastrum(tetraploid) 2	53.855
	CNS0095609	Whole white alabastrum(tetraploid) 3	48.444
	CNS0095610	Silvery flower (tetraploid) 1	67.925
	CNS0095611	Silvery flower (tetraploid) 2	46.228
	CNS0095612	Silvery flower (tetraploid) 3	47.231
	CNS0095613	Golden flower (tetraploid) 1	70.163
	CNS0095614	Golden flower (tetraploid) 2	70.962
	CNS0095615	Golden flower (tetraploid) 3	77.431
CRA001975	CRR073297	Stem 1	37.139
	CRR073298	Stem 2	37.879
	CRR073299	Stem 3	47.906
	CRR073300	Leaf 1	41.216
	CRR073301	Leaf 2	41.039
	CRR073302	Leaf 3	47.000
	CRR073303	Juvenile bud 1	39.405
	CRR073304	Juvenile bud 2	46.403
	CRR073305	Juvenile bud 3	38.183
	CRR073306	Third green 1	59.041
	CRR073307	Third green 2	67.821
	CRR073308	Third green 3	44.698
	CRR073309	Second white 1	42.133
	CRR073310	Second white 2	40.900
	CRR073311	Second white 3	31.154
	CRR073312	Silver flowering 1	31.866
	CRR073313	Silver flowering 2	33.661
	CRR073314	Silver flowering 3	25.106
	CRR073315	Gold flowering 1	31.331
	CRR073316	Gold flowering 2	33.553
	CRR073317	Gold flowering 3	42.171
	CRR073318	Tawny withering 1	49.181
	CRR073319	Tawny withering 2	51.862
	CRR073320	Tawny withering 3	44.069