Gene detail

Detail information of GWHGAAZE024312

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KDO39604.1	9.3374E-158	hypothetical protein CISIN_1g012219mg [Citrus sinensis]
COG	YP_226417.1	1E-26	serine/threonine protein kinase
Swissprot	tr\|Q8VZG8\|Y4885_ARATH	5E-106	Probable LRR receptor-like serine/threonine-protein kinase At4g08850 (Precursor)
trEMBL	tr\|A0A067D9C8\|A0A067D9C8_CITSI	3E-158	Uncharacterized protein {ECO:0000313\|EMBL:KDO39604.1}
TAIR10	AT4G08850.1	4E-88	Leucine-rich repeat receptor-like protein kinase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	39855864	39857196	+
GWHAAZE00000007	mRNA	39855864	39857196	+
GWHAAZE00000007	exon	39855864	39856611	+
GWHAAZE00000007	exon	39856826	39857196	+
GWHAAZE00000007	CDS	39855864	39856611	+
GWHAAZE00000007	CDS	39856826	39857196	+

Transcript Sequence
>GWHTAAZE024346 ATGTCTTCAAAAGACACTACGAACGCAATCAAGCTTTTTTGCCTCATCGCTCTTCCTGCCGAAATTTCCATCGTTATCTTAATCGTTCTCCTAATTAGGTTCTTTTTCAGGCGCAAGGCTATAGAAGGTGGGAGCAAAGCAAGAGTAATGAAGCACGGAGATATGTGCTCCATATGGAATTATGATGGGACAATTGCGTACGAAGACATTATCAAATCAACAAATGACTTTGATATTAAATACTGCATTGGTACTGGCGGGTATGGCAGCGTCTACCGTGCTCTCCTACCTTGTGGCAAAGTTGTCGCCTTAAAGAAACTTGATCCATTTGAAGTCGAGGAACCAGCTTTCAACCAGAGTTTCAAGAATGAGGCACAAGTTTTATCAAACATAAGACATAAAAACATTGTAAAGCTTTACGGGTTTTGTTTACACAATAGATGCATGTTCCTCGTTTATGAATACATGGAAAGAGGAAGCTTATTCTGCGCCCTAAGAGATGATACTGAGGCAGTTGAATTGGATTGGAGTAGAAGGGTGAACATTGTTAAAGGCATAGCACATGCTTTATCATACATGCATCGCGATTGTACTCCACCTATTGTTCATCGGGATATTTCAAGTAATAATATACTCTTAAACTCTAAACTGGAGGCATTTGTAGCCGACTTCGGTGCTGCTAGATTGCTATCTGCCGATTCGTCCAATCAAACTTTAATTGCAGGCACCTATGGATATATTGCTCCAGAACTTTCCTACACCATGGTAGTGACCGAAAAATGCGATGTTTATAGCTTTGGGGTGGTCGCATTTGAAATAATCATGGGAAAGCATCCAGGTGATCTTCTTTCATCATTAACTTCTCTGTCAACACAAAACCCAACAGTGAATGATGTCTTGGACCCACGGCTCTCACATCCAACAGATCGACTTGTTGAATGGGACATCGTTATGGTTCTGAGGTTGGCCTTTTCATGCTTATGTTCTAATCCTAAATCTCGGCCAACAATGGAAAGCGTGTCACAAGCGTTGCTAGTACGCAGGACGCCACTACCCAAGCCTCTTCACTTGATTTCACTATTAGAGCTGTCGAGTCAGCAGAAATGTTTGATGAATTAA

Network for GWHGAAZE024312

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00069.26	Pkinase	81	342	1.30E-45

Protein Sequence

Gene family

Gene family	subfamily
Protein Kinases Family	RLK-Pelle_LRR-XI-1

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006468	biological_process	protein phosphorylation
GO:0004672	molecular_function	protein kinase activity
GO:0005524	molecular_function	ATP binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.399
	SRR3591707	mature leaf	1.530
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	1.352
	SRR3591710	White floral bud	0.379
	SRR3591711	White flower	2.471
	SRR3591712	Green floral bud	0.426
	SRR3591713	Yellow flower	0.063
SRP173429	SRR8316895	Juvenile bud stage	0.488
	SRR8316896	Juvenile bud stage	0.896
	SRR8316897	Juvenile bud stage	0.990
	SRR8316894	Third green stage	0.448
	SRR8316900	Third green stage	0.179
	SRR8316901	Third green stage	0.403
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.653
	SRR8316903	Complete white stage	0.280
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	1.310
	SRR6706287	Light intensity 50%	1.167
	SRR6706288	Light intensity 20%	0.609
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.773
	CNS0095593	Slightly white alabastrum(diploid) 2	0.337
	CNS0095594	Slightly white alabastrum(diploid) 3	0.539
	CNS0095595	Whole white alabastrum(diploid) 2	0.161
	CNS0095596	Whole white alabastrum(diploid) 3	0.000
	CNS0095597	Whole white alabastrum(diploid) 4	0.068
	CNS0095598	Silvery flower (diploied) 1	1.094
	CNS0095599	Silvery flower (diploied) 2	0.194
	CNS0095600	Silvery flower (diploied) 3	0.260
	CNS0095601	Golden flower (diploid) 1	1.255
	CNS0095602	Golden flower (diploid) 2	0.446
	CNS0095603	Golden flower (diploid) 3	0.243
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.091
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.280
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.000
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.138
	CNS0095610	Silvery flower (tetraploid) 1	0.426
	CNS0095611	Silvery flower (tetraploid) 2	0.068
	CNS0095612	Silvery flower (tetraploid) 3	0.052
	CNS0095613	Golden flower (tetraploid) 1	0.000
	CNS0095614	Golden flower (tetraploid) 2	0.615
	CNS0095615	Golden flower (tetraploid) 3	0.020
CRA001975	CRR073297	Stem 1	0.290
	CRR073298	Stem 2	0.527
	CRR073299	Stem 3	0.108
	CRR073300	Leaf 1	0.050
	CRR073301	Leaf 2	0.548
	CRR073302	Leaf 3	0.257
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.048
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.035
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.878
	CRR073316	Gold flowering 2	0.600
	CRR073317	Gold flowering 3	0.706
	CRR073318	Tawny withering 1	0.626
	CRR073319	Tawny withering 2	2.154
	CRR073320	Tawny withering 3	0.609