Gene detail

Detail information of GWHGAAZE024070

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CBI19004.3	3.96091E-35	unnamed protein product [Vitis vinifera]
Swissprot	tr\|O80365\|ARR8_ARATH	2E-25	Two-component response regulator ARR8
trEMBL	tr\|E0CR50\|E0CR50_VITVI	1E-35	Putative uncharacterized protein {ECO:0000313\|EMBL:CBI19004.3}
TAIR10	AT2G41310.1	3E-20	response regulator 3

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	34298127	34300220	+
GWHAAZE00000007	mRNA	34298127	34300220	+
GWHAAZE00000007	exon	34298127	34298280	+
GWHAAZE00000007	exon	34299161	34299330	+
GWHAAZE00000007	exon	34300083	34300220	+
GWHAAZE00000007	CDS	34298127	34298280	+
GWHAAZE00000007	CDS	34299161	34299330	+
GWHAAZE00000007	CDS	34300083	34300220	+

Transcript Sequence
>GWHTAAZE024104 AACAAGCAGAAGAAGCAAGAAGAAGAAGACGAGATTATTAAGAAGCAAGGAGGAGAAGGAGGAAAACATGAGTTGTTACATGTGTTAGCTGTGGATGATAGTCTTATTGACAGAAAGCTCTTGGAAAAGCTCCTCACTGTTTCTTCTTACCAAGTAACATGTGTGGAATCTGGGGATAAAGCTTTGGAATACTTGGGTTTGCTACATAATAATAACAATAGCAATGCAGAGATTATTAGTGATTCTACAACTTCCTCTTGCGCTTCTTGTACTTGTACCGCTTCTTCTTCTTCTTCTTCATCATCCCAAACATCAAAACAAGAGCTGCAAGGATCCAAAGTGAACTTGATCATGACAGATTATAGTATGCCGGGGATGAGCGGTTATGATTTGCTCAAAATAGTCAAGGTCAATAAAAATCAAATTAATACATACATGATGAGCTGTCCATCTTTACACTAA

Network for GWHGAAZE024070

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
--	--	--	--	--

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	Others

KEGG pathway

KO	Enzyme	pathway	mapID
K14492	ARR-A	Plant hormone signal transduction	map04075

Gene Ontology

GO term	Ontology	Name
GO:0000160	biological_process	phosphorelay signal transduction system

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.767
	SRR3591706	second leaf	11.550
	SRR3591707	mature leaf	2.622
	SRR3591708	Shoot apex	23.255
	SRR3591709	Stem	3.301
	SRR3591710	White floral bud	6.831
	SRR3591711	White flower	7.558
	SRR3591712	Green floral bud	30.765
	SRR3591713	Yellow flower	0.294
SRP173429	SRR8316895	Juvenile bud stage	14.520
	SRR8316896	Juvenile bud stage	21.905
	SRR8316897	Juvenile bud stage	8.755
	SRR8316894	Third green stage	20.403
	SRR8316900	Third green stage	65.279
	SRR8316901	Third green stage	87.152
	SRR8316898	Complete white stage	0.792
	SRR8316899	Complete white stage	26.466
	SRR8316903	Complete white stage	6.732
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	1.165
	SRR8316905	Silver flowering stage	0.007
	SRR8316906	Gold flowering stage	0.160
	SRR8316907	Gold flowering stage	0.172
	SRR8316908	Gold flowering stage	0.389
SRP132670	SRR6706286	Control	2.539
	SRR6706287	Light intensity 50%	3.391
	SRR6706288	Light intensity 20%	4.118
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	14.303
	CNS0095593	Slightly white alabastrum(diploid) 2	37.126
	CNS0095594	Slightly white alabastrum(diploid) 3	18.672
	CNS0095595	Whole white alabastrum(diploid) 2	34.242
	CNS0095596	Whole white alabastrum(diploid) 3	31.897
	CNS0095597	Whole white alabastrum(diploid) 4	23.442
	CNS0095598	Silvery flower (diploied) 1	60.380
	CNS0095599	Silvery flower (diploied) 2	38.843
	CNS0095600	Silvery flower (diploied) 3	6.162
	CNS0095601	Golden flower (diploid) 1	29.518
	CNS0095602	Golden flower (diploid) 2	11.397
	CNS0095603	Golden flower (diploid) 3	10.672
	CNS0095604	Slightly white alabastrum(tetraploid) 1	22.281
	CNS0095605	Slightly white alabastrum(tetraploid) 2	11.301
	CNS0095606	Slightly white alabastrum(tetraploid) 3	57.409
	CNS0095607	Whole white alabastrum(tetraploid) 1	22.115
	CNS0095608	Whole white alabastrum(tetraploid) 2	10.861
	CNS0095609	Whole white alabastrum(tetraploid) 3	21.127
	CNS0095610	Silvery flower (tetraploid) 1	4.275
	CNS0095611	Silvery flower (tetraploid) 2	7.065
	CNS0095612	Silvery flower (tetraploid) 3	2.049
	CNS0095613	Golden flower (tetraploid) 1	0.373
	CNS0095614	Golden flower (tetraploid) 2	0.726
	CNS0095615	Golden flower (tetraploid) 3	0.099
CRA001975	CRR073297	Stem 1	11.492
	CRR073298	Stem 2	20.092
	CRR073299	Stem 3	11.924
	CRR073300	Leaf 1	32.856
	CRR073301	Leaf 2	46.852
	CRR073302	Leaf 3	14.990
	CRR073303	Juvenile bud 1	4.965
	CRR073304	Juvenile bud 2	3.313
	CRR073305	Juvenile bud 3	3.589
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.079
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.101
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.745
	CRR073316	Gold flowering 2	0.667
	CRR073317	Gold flowering 3	2.277
	CRR073318	Tawny withering 1	3.063
	CRR073319	Tawny withering 2	0.136
	CRR073320	Tawny withering 3	0.171