Gene detail

Detail information of GWHGAAZE023846

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004141048.1	2.52255E-72	PREDICTED: uncharacterized protein LOC101203477 [Cucumis sativus]
trEMBL	tr\|A0A0A0LIN6\|A0A0A0LIN6_CUCSA	9E-73	Uncharacterized protein {ECO:0000313\|EMBL:KGN60547.1}
TAIR10	AT4G29480.1	1E-53	Mitochondrial ATP synthase subunit G protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	28006832	28009438	+
GWHAAZE00000007	mRNA	28006832	28009438	+
GWHAAZE00000007	exon	28006832	28007013	+
GWHAAZE00000007	exon	28009252	28009438	+
GWHAAZE00000007	CDS	28006832	28007013	+
GWHAAZE00000007	CDS	28009252	28009438	+

Transcript Sequence
>GWHTAAZE023876 ATGGCGTCAAAGCTGCATCAATTGCAATCAAAGGCTACTCAAGCGTCAAAGCTTGCTTCAAAACATGCGTCTTCCTATTACAAGCAGCTACTAGAGAAGAACAAGCAATACATTCAAGAACCACCTACTGTGGAGAAATGCCAGCTCCTGTCAAACCAGCTCTTCTACACTCGTCTTGCCAGTTTACCTGGTCGCTATGAGTCATTCTGGAAGGAAGTTGATTATGTGAAGCAACTGTGGAAAAAAAGGCAGGAGCTAAAAATCGAGGATGCAGGAATTGCTGCTCTTTTCGGTCTTGAATGCTTTGCCTGGTTTTGTGCTGGAGAGATTGTAGGACGAGGTTTTACGATCACTGGTTACCATGTTTAA

Network for GWHGAAZE023846

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04718.16	ATP-synt_G	16	121	1.30E-23

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K02140	ATPeFG, ATP5L, ATP20	Metabolic pathways	map01100
		Oxidative phosphorylation	map00190
		Thermogenesis	map04714

Gene Ontology

GO term	Ontology	Name
GO:0015986	biological_process	ATP synthesis coupled proton transport
GO:0000276	cellular_component	mitochondrial proton-transporting ATP synthase complex, coupling factor F(o)
GO:0015078	molecular_function	proton transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.820
	SRR3591706	second leaf	16.523
	SRR3591707	mature leaf	9.876
	SRR3591708	Shoot apex	38.275
	SRR3591709	Stem	26.909
	SRR3591710	White floral bud	11.069
	SRR3591711	White flower	17.703
	SRR3591712	Green floral bud	21.995
	SRR3591713	Yellow flower	16.178
SRP173429	SRR8316895	Juvenile bud stage	13.822
	SRR8316896	Juvenile bud stage	16.171
	SRR8316897	Juvenile bud stage	15.504
	SRR8316894	Third green stage	6.057
	SRR8316900	Third green stage	16.496
	SRR8316901	Third green stage	14.441
	SRR8316898	Complete white stage	4.224
	SRR8316899	Complete white stage	11.931
	SRR8316903	Complete white stage	5.888
	SRR8316902	Silver flowering stage	5.562
	SRR8316904	Silver flowering stage	4.028
	SRR8316905	Silver flowering stage	3.164
	SRR8316906	Gold flowering stage	9.959
	SRR8316907	Gold flowering stage	13.390
	SRR8316908	Gold flowering stage	16.473
SRP132670	SRR6706286	Control	13.000
	SRR6706287	Light intensity 50%	13.101
	SRR6706288	Light intensity 20%	13.306
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	22.996
	CNS0095593	Slightly white alabastrum(diploid) 2	17.143
	CNS0095594	Slightly white alabastrum(diploid) 3	19.048
	CNS0095595	Whole white alabastrum(diploid) 2	17.399
	CNS0095596	Whole white alabastrum(diploid) 3	14.127
	CNS0095597	Whole white alabastrum(diploid) 4	13.583
	CNS0095598	Silvery flower (diploied) 1	13.381
	CNS0095599	Silvery flower (diploied) 2	13.840
	CNS0095600	Silvery flower (diploied) 3	13.006
	CNS0095601	Golden flower (diploid) 1	10.775
	CNS0095602	Golden flower (diploid) 2	13.597
	CNS0095603	Golden flower (diploid) 3	12.116
	CNS0095604	Slightly white alabastrum(tetraploid) 1	19.316
	CNS0095605	Slightly white alabastrum(tetraploid) 2	20.737
	CNS0095606	Slightly white alabastrum(tetraploid) 3	25.672
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.314
	CNS0095608	Whole white alabastrum(tetraploid) 2	12.728
	CNS0095609	Whole white alabastrum(tetraploid) 3	18.607
	CNS0095610	Silvery flower (tetraploid) 1	12.836
	CNS0095611	Silvery flower (tetraploid) 2	14.653
	CNS0095612	Silvery flower (tetraploid) 3	11.960
	CNS0095613	Golden flower (tetraploid) 1	9.399
	CNS0095614	Golden flower (tetraploid) 2	9.616
	CNS0095615	Golden flower (tetraploid) 3	8.974
CRA001975	CRR073297	Stem 1	26.721
	CRR073298	Stem 2	16.691
	CRR073299	Stem 3	33.554
	CRR073300	Leaf 1	12.632
	CRR073301	Leaf 2	17.360
	CRR073302	Leaf 3	19.723
	CRR073303	Juvenile bud 1	15.106
	CRR073304	Juvenile bud 2	11.630
	CRR073305	Juvenile bud 3	13.850
	CRR073306	Third green 1	2.492
	CRR073307	Third green 2	3.240
	CRR073308	Third green 3	2.244
	CRR073309	Second white 1	7.644
	CRR073310	Second white 2	7.005
	CRR073311	Second white 3	3.240
	CRR073312	Silver flowering 1	3.832
	CRR073313	Silver flowering 2	8.982
	CRR073314	Silver flowering 3	3.604
	CRR073315	Gold flowering 1	11.578
	CRR073316	Gold flowering 2	13.780
	CRR073317	Gold flowering 3	9.829
	CRR073318	Tawny withering 1	21.068
	CRR073319	Tawny withering 2	18.497
	CRR073320	Tawny withering 3	24.182