Gene detail

Detail information of GWHGAAZE023654

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	XP_004303450.1	1.09599E-62	PREDICTED: copper transporter 5-like [Fragaria vesca subsp. vesca]
Swissprot	tr\|Q93VM8\|COPT5_ARATH	2E-50	Copper transporter 5
trEMBL	tr\|E9LK45\|E9LK45_VITVI	5E-62	Copper transporter {ECO:0000313\|EMBL:ADW93919.1}
TAIR10	AT5G20650.1	3E-31	copper transporter 5

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	20959065	20959517	+
GWHAAZE00000007	mRNA	20959065	20959517	+
GWHAAZE00000007	exon	20959065	20959517	+
GWHAAZE00000007	CDS	20959065	20959517	+

Transcript Sequence
>GWHTAAZE023684 ATGATGCACATGACCTTCTACTGGTCTCGATCCGTCACCCTCCTCTTCGATTCATGGAAAACAGACACTTGGTTCAGCTACGTTCTCACTTTGCTCGCCTGCTTCCTCTTCTCCGCCTTCTATCAGTACCTCGAGCACAAGCGCATCCGCGTCAAACTAATATCATCTACATCGTCAACCAGGCCGGGGTCTCCGATTAGTGTGCCTCTCCTCCAGACTAAAATCCCGGCCTCCGCGGGAGGTAAATGGAGTTTTCTGAGATTCGCTGGCGCGGTGTTGTTTTGCGTCAACGCCGCGATCGGGTACCTGCTCATGCTCGCTATCATGTCGTTCAACGGCGGAGTTTTTGTCGCGGTTGTTGTCGGCCTTGGATTCGGGTACTTGCTGTTTAGGAGCGGCGCCGATGATGAAATTGTTGAGCCTGTGATTGAAAATTCTTGCGCTTGCGCCTGA

Network for GWHGAAZE023654

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF04145.16	Ctr	4	130	1.90E-22

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K14686	SLC31A1, CTR1	Mineral absorption	map04978

Gene Ontology

GO term	Ontology	Name
GO:0035434	biological_process	copper ion transmembrane transport
GO:0016021	cellular_component	integral component of membrane
GO:0005375	molecular_function	copper ion transmembrane transporter activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	117.898
	SRR3591706	second leaf	62.726
	SRR3591707	mature leaf	73.815
	SRR3591708	Shoot apex	53.665
	SRR3591709	Stem	231.187
	SRR3591710	White floral bud	128.801
	SRR3591711	White flower	116.411
	SRR3591712	Green floral bud	101.612
	SRR3591713	Yellow flower	106.728
SRP173429	SRR8316895	Juvenile bud stage	36.185
	SRR8316896	Juvenile bud stage	60.609
	SRR8316897	Juvenile bud stage	20.571
	SRR8316894	Third green stage	25.415
	SRR8316900	Third green stage	71.439
	SRR8316901	Third green stage	75.342
	SRR8316898	Complete white stage	78.647
	SRR8316899	Complete white stage	141.400
	SRR8316903	Complete white stage	131.539
	SRR8316902	Silver flowering stage	71.521
	SRR8316904	Silver flowering stage	96.551
	SRR8316905	Silver flowering stage	53.889
	SRR8316906	Gold flowering stage	163.829
	SRR8316907	Gold flowering stage	149.453
	SRR8316908	Gold flowering stage	136.954
SRP132670	SRR6706286	Control	106.742
	SRR6706287	Light intensity 50%	94.368
	SRR6706288	Light intensity 20%	103.115
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	80.430
	CNS0095593	Slightly white alabastrum(diploid) 2	81.069
	CNS0095594	Slightly white alabastrum(diploid) 3	68.903
	CNS0095595	Whole white alabastrum(diploid) 2	80.262
	CNS0095596	Whole white alabastrum(diploid) 3	73.904
	CNS0095597	Whole white alabastrum(diploid) 4	95.366
	CNS0095598	Silvery flower (diploied) 1	109.329
	CNS0095599	Silvery flower (diploied) 2	125.422
	CNS0095600	Silvery flower (diploied) 3	217.140
	CNS0095601	Golden flower (diploid) 1	154.331
	CNS0095602	Golden flower (diploid) 2	248.199
	CNS0095603	Golden flower (diploid) 3	239.296
	CNS0095604	Slightly white alabastrum(tetraploid) 1	62.404
	CNS0095605	Slightly white alabastrum(tetraploid) 2	58.578
	CNS0095606	Slightly white alabastrum(tetraploid) 3	51.955
	CNS0095607	Whole white alabastrum(tetraploid) 1	72.132
	CNS0095608	Whole white alabastrum(tetraploid) 2	69.315
	CNS0095609	Whole white alabastrum(tetraploid) 3	49.612
	CNS0095610	Silvery flower (tetraploid) 1	95.159
	CNS0095611	Silvery flower (tetraploid) 2	151.737
	CNS0095612	Silvery flower (tetraploid) 3	195.588
	CNS0095613	Golden flower (tetraploid) 1	199.098
	CNS0095614	Golden flower (tetraploid) 2	101.212
	CNS0095615	Golden flower (tetraploid) 3	134.598
CRA001975	CRR073297	Stem 1	102.979
	CRR073298	Stem 2	96.175
	CRR073299	Stem 3	124.101
	CRR073300	Leaf 1	97.626
	CRR073301	Leaf 2	122.572
	CRR073302	Leaf 3	109.425
	CRR073303	Juvenile bud 1	172.559
	CRR073304	Juvenile bud 2	225.655
	CRR073305	Juvenile bud 3	221.957
	CRR073306	Third green 1	179.645
	CRR073307	Third green 2	234.717
	CRR073308	Third green 3	170.788
	CRR073309	Second white 1	281.841
	CRR073310	Second white 2	182.590
	CRR073311	Second white 3	151.197
	CRR073312	Silver flowering 1	194.855
	CRR073313	Silver flowering 2	250.024
	CRR073314	Silver flowering 3	213.993
	CRR073315	Gold flowering 1	163.882
	CRR073316	Gold flowering 2	172.070
	CRR073317	Gold flowering 3	215.289
	CRR073318	Tawny withering 1	219.897
	CRR073319	Tawny withering 2	193.189
	CRR073320	Tawny withering 3	200.176