Gene detail

Detail information of GWHGAAZE023622

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	EYU29129.1	1.86564E-44	hypothetical protein MIMGU_mgv1a023759mg [Erythranthe guttata]
trEMBL	tr\|A0A022QNF5\|A0A022QNF5_ERYGU	7E-45	Uncharacterized protein {ECO:0000313\|EMBL:EYU29129.1}
TAIR10	AT4G19420.1	3E-37	Pectinacetylesterase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	18245687	18247208	+
GWHAAZE00000007	mRNA	18245687	18247208	+
GWHAAZE00000007	exon	18245687	18245749	+
GWHAAZE00000007	exon	18245845	18245898	+
GWHAAZE00000007	exon	18245984	18246061	+
GWHAAZE00000007	exon	18246179	18246287	+
GWHAAZE00000007	exon	18246857	18247005	+
GWHAAZE00000007	exon	18247107	18247208	+
GWHAAZE00000007	CDS	18245687	18245749	+
GWHAAZE00000007	CDS	18245845	18245898	+
GWHAAZE00000007	CDS	18245984	18246061	+
GWHAAZE00000007	CDS	18246179	18246287	+
GWHAAZE00000007	CDS	18246857	18247005	+
GWHAAZE00000007	CDS	18247107	18247208	+

Transcript Sequence
>GWHTAAZE023652 AAAGATTTCTATGGAGGATATCGCTTTGAACATGCGAAGTTTGACAAAGTCGTTGACCTACATGGGTCAGCAAAGAATTTGCCACAGACTTGTACTTCAAAGATTAAACCAAGTCTGTGCTTCTACCCACAAAACGTTATTCGTCGTATTGAAACCCCACTATTTATTTTAAATTCAGTCTTTGATTCGTATCAGCTTGAGTACGTTTTTGCCCTTACATATCTACCTAAAGTCGGCCACTCCTGGATGAAATGCCCAAATAACACAAAGTACTGCTCATCCAGCCAAATCAAGAGATTGGAAGGTTTACAGTCAGAATTTGTGAACACAGTTTTGACTAGGTTGGGTAACCACCCTTCCTCTAGAGGCTTGTTCATCAATTCTTGTTATGCTCATTGCCAATCTTTGTTTGGGCCCAGTTGGCTTGGACCTAATGTTACACTAAATCACAAGACGATTTCTGAGACTGTTGGGGATTGGTTTTACGATAGACGTGTGGTGCACCTCATAGATCACAAACACAACTTGCCACATACGTGTGTGCATGAAAACTGA

Network for GWHGAAZE023622

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF03283.14	PAE	12	165	1.10E-41

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K19882	NOTUM	Wnt signaling pathway	map04310

Gene Ontology

GO term	Ontology	Name
GO:0016787	molecular_function	hydrolase activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	0.000
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	0.000
	SRR3591708	Shoot apex	0.000
	SRR3591709	Stem	0.000
	SRR3591710	White floral bud	8.164
	SRR3591711	White flower	5.951
	SRR3591712	Green floral bud	7.156
	SRR3591713	Yellow flower	2.485
SRP173429	SRR8316895	Juvenile bud stage	0.137
	SRR8316896	Juvenile bud stage	1.135
	SRR8316897	Juvenile bud stage	4.384
	SRR8316894	Third green stage	1.365
	SRR8316900	Third green stage	1.580
	SRR8316901	Third green stage	4.445
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.499
	SRR8316903	Complete white stage	0.090
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.156
SRP132670	SRR6706286	Control	0.188
	SRR6706287	Light intensity 50%	0.064
	SRR6706288	Light intensity 20%	0.225
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	1.340
	CNS0095593	Slightly white alabastrum(diploid) 2	1.608
	CNS0095594	Slightly white alabastrum(diploid) 3	1.535
	CNS0095595	Whole white alabastrum(diploid) 2	0.664
	CNS0095596	Whole white alabastrum(diploid) 3	0.709
	CNS0095597	Whole white alabastrum(diploid) 4	0.897
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.097
	CNS0095601	Golden flower (diploid) 1	0.000
	CNS0095602	Golden flower (diploid) 2	0.000
	CNS0095603	Golden flower (diploid) 3	0.000
	CNS0095604	Slightly white alabastrum(tetraploid) 1	5.617
	CNS0095605	Slightly white alabastrum(tetraploid) 2	8.129
	CNS0095606	Slightly white alabastrum(tetraploid) 3	3.490
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.751
	CNS0095608	Whole white alabastrum(tetraploid) 2	2.613
	CNS0095609	Whole white alabastrum(tetraploid) 3	17.298
	CNS0095610	Silvery flower (tetraploid) 1	44.919
	CNS0095611	Silvery flower (tetraploid) 2	14.189
	CNS0095612	Silvery flower (tetraploid) 3	17.619
	CNS0095613	Golden flower (tetraploid) 1	0.478
	CNS0095614	Golden flower (tetraploid) 2	32.940
	CNS0095615	Golden flower (tetraploid) 3	5.356
CRA001975	CRR073297	Stem 1	0.623
	CRR073298	Stem 2	1.108
	CRR073299	Stem 3	0.461
	CRR073300	Leaf 1	0.532
	CRR073301	Leaf 2	0.277
	CRR073302	Leaf 3	1.280
	CRR073303	Juvenile bud 1	0.390
	CRR073304	Juvenile bud 2	0.021
	CRR073305	Juvenile bud 3	0.000
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.000
	CRR073319	Tawny withering 2	0.000
	CRR073320	Tawny withering 3	0.230