Gene detail

Detail information of GWHGAAZE023516

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP02628.1	1.83641E-64	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9FMC2\|BZP43_ARATH	3E-14	Basic leucine zipper 43
trEMBL	tr\|A0A068U4U6\|A0A068U4U6_COFCA	7E-65	Coffea canephora DH200=94 genomic scaffold, scaffold_8 {ECO:0000313\|EMBL:CDP02628.1}
TAIR10	AT4G37730.1	6E-21	basic leucine-zipper 7

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000007	gene	11201134	11201709	+
GWHAAZE00000007	mRNA	11201134	11201709	+
GWHAAZE00000007	exon	11201134	11201709	+
GWHAAZE00000007	CDS	11201134	11201709	+

Transcript Sequence
>GWHTAAZE023546 ATGTTGTCCTTCGACAGCCTCTCTGAATACCATTTTCCGGCATTCGATGGGGGTTTTCCCCCTTGGGATTTCCAAGACCCCCCTTTTGTATTTCAACAACAGGACCCCTTTATATCCCCAAATCACTCCCCCGAACCAGTTTTTTCAAACCCAAACAGCTCAAACTCCGGTTCACCAGAACCGAACCGGTCAAACTCCGGTTCAGATGAACCGGACCGTGTCTCGAAAATAGACGAGCGGAAAAGAAGGCGGATGCTGTCGAACCGGGAGTCTGCCCGCCGGTCCAGAATGAGAAAGCAAAAACACCTGGAGAATCTGAGGAATCAAGTGAACCGGCTTAGGATTGGGAACCGGGACATGATGAACCGGCTGCGTTTGGTTACGCACCAAACCCAGTTCGTACGGACGGATAACGACCGGCTCCTGTCGGAGTCGGCAATTCTTCGGCAGAAACTATGGGATATACGCCAAGTCTTGCTTGTCCGTCAACTACAGCAGCAGATTTCTCCCTCTGCATGGCCATGCAATAATTTCACGTCAATCAATGAACAAAATCTACCACCATTAACTACATAA

Network for GWHGAAZE023516

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00170.22	bZIP_1	80	132	1.80E-08

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	bZIP

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	14.485
	SRR3591706	second leaf	1.106
	SRR3591707	mature leaf	3.080
	SRR3591708	Shoot apex	4.501
	SRR3591709	Stem	29.275
	SRR3591710	White floral bud	3.140
	SRR3591711	White flower	2.893
	SRR3591712	Green floral bud	1.270
	SRR3591713	Yellow flower	5.754
SRP173429	SRR8316895	Juvenile bud stage	0.076
	SRR8316896	Juvenile bud stage	0.521
	SRR8316897	Juvenile bud stage	0.224
	SRR8316894	Third green stage	0.432
	SRR8316900	Third green stage	0.892
	SRR8316901	Third green stage	0.514
	SRR8316898	Complete white stage	0.658
	SRR8316899	Complete white stage	1.995
	SRR8316903	Complete white stage	2.639
	SRR8316902	Silver flowering stage	0.609
	SRR8316904	Silver flowering stage	0.442
	SRR8316905	Silver flowering stage	0.154
	SRR8316906	Gold flowering stage	0.533
	SRR8316907	Gold flowering stage	1.777
	SRR8316908	Gold flowering stage	0.252
SRP132670	SRR6706286	Control	1.864
	SRR6706287	Light intensity 50%	1.721
	SRR6706288	Light intensity 20%	1.011
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.874
	CNS0095593	Slightly white alabastrum(diploid) 2	1.122
	CNS0095594	Slightly white alabastrum(diploid) 3	0.153
	CNS0095595	Whole white alabastrum(diploid) 2	1.665
	CNS0095596	Whole white alabastrum(diploid) 3	1.095
	CNS0095597	Whole white alabastrum(diploid) 4	0.508
	CNS0095598	Silvery flower (diploied) 1	1.489
	CNS0095599	Silvery flower (diploied) 2	0.420
	CNS0095600	Silvery flower (diploied) 3	0.190
	CNS0095601	Golden flower (diploid) 1	0.806
	CNS0095602	Golden flower (diploid) 2	0.508
	CNS0095603	Golden flower (diploid) 3	0.374
	CNS0095604	Slightly white alabastrum(tetraploid) 1	1.884
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.422
	CNS0095606	Slightly white alabastrum(tetraploid) 3	2.163
	CNS0095607	Whole white alabastrum(tetraploid) 1	1.094
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.491
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.178
	CNS0095610	Silvery flower (tetraploid) 1	0.568
	CNS0095611	Silvery flower (tetraploid) 2	0.367
	CNS0095612	Silvery flower (tetraploid) 3	1.469
	CNS0095613	Golden flower (tetraploid) 1	0.858
	CNS0095614	Golden flower (tetraploid) 2	0.354
	CNS0095615	Golden flower (tetraploid) 3	0.427
CRA001975	CRR073297	Stem 1	1.668
	CRR073298	Stem 2	1.966
	CRR073299	Stem 3	1.114
	CRR073300	Leaf 1	1.253
	CRR073301	Leaf 2	2.775
	CRR073302	Leaf 3	1.311
	CRR073303	Juvenile bud 1	1.148
	CRR073304	Juvenile bud 2	1.975
	CRR073305	Juvenile bud 3	2.075
	CRR073306	Third green 1	1.117
	CRR073307	Third green 2	1.425
	CRR073308	Third green 3	1.185
	CRR073309	Second white 1	1.159
	CRR073310	Second white 2	1.517
	CRR073311	Second white 3	1.385
	CRR073312	Silver flowering 1	1.926
	CRR073313	Silver flowering 2	2.575
	CRR073314	Silver flowering 3	4.861
	CRR073315	Gold flowering 1	1.385
	CRR073316	Gold flowering 2	1.349
	CRR073317	Gold flowering 3	2.602
	CRR073318	Tawny withering 1	41.739
	CRR073319	Tawny withering 2	21.955
	CRR073320	Tawny withering 3	18.785