Gene detail

Detail information of GWHGAAZE023031

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	KGN51692.1	3.74131E-58	hypothetical protein Csa_5G590090 [Cucumis sativus]
Swissprot	tr\|Q9CAG3\|LOX6_ARATH	6E-49	Lipoxygenase 6, chloroplastic (Precursor)
trEMBL	tr\|A0A0A0KTE1\|A0A0A0KTE1_CUCSA	1E-58	Uncharacterized protein {ECO:0000313\|EMBL:KGN51692.1}
TAIR10	AT1G67560.1	6E-36	PLAT/LH2 domain-containing lipoxygenase family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	82271234	82271623	-
GWHAAZE00000006	mRNA	82271234	82271623	-
GWHAAZE00000006	exon	82271234	82271623	-
GWHAAZE00000006	CDS	82271234	82271623	-

Transcript Sequence
>GWHTAAZE023061 ATGAGAAAGCTTATCCCTGAAGATGACCCTGCTTACAAGAAATTTCTGATTAACCAACAGCTTACTTTTCTTTCATCTTTACCGACTCAACTGCAAGCCACCAAGGTAATGGCAGTGCAAGACACCTTGCCGACTCACTCTCCTGATGAAGAGTACTTGGGTAAGGAGCACCATCTTGAGAGGTATTGGACTAGTGTTCAAGAAATTCTAAGACTGTTTGATAGATTTTTGGCTAAGCTAGAGGAGATAGAAAAGACGTTAAATAAAAGAAACAAGAATAACCGTTTGAAAAACCGATGCGGTGCTGGCATTCCTCCATATGAACTGCTTCTTCCCTCATCAGCTCTGGGTGTAACTGGCCGAGGTATACCCAACAGCATATCTATTTGA

Network for GWHGAAZE023031

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00305.20	Lipoxygenase	1	112	2.90E-31

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
K00454	LOX2S	Metabolic pathways	map01100
		Biosynthesis of secondary metabolites	map01110
		Linoleic acid metabolism	map00591
		alpha-Linolenic acid metabolism	map00592

Gene Ontology

GO term	Ontology	Name
GO:0055114	biological_process	oxidation-reduction process
GO:0016702	molecular_function	oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen
GO:0046872	molecular_function	metal ion binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.848
	SRR3591706	second leaf	5.221
	SRR3591707	mature leaf	3.082
	SRR3591708	Shoot apex	6.441
	SRR3591709	Stem	5.898
	SRR3591710	White floral bud	1.110
	SRR3591711	White flower	0.621
	SRR3591712	Green floral bud	2.094
	SRR3591713	Yellow flower	0.304
SRP173429	SRR8316895	Juvenile bud stage	0.161
	SRR8316896	Juvenile bud stage	0.075
	SRR8316897	Juvenile bud stage	0.070
	SRR8316894	Third green stage	0.238
	SRR8316900	Third green stage	0.035
	SRR8316901	Third green stage	0.048
	SRR8316898	Complete white stage	0.000
	SRR8316899	Complete white stage	0.000
	SRR8316903	Complete white stage	0.000
	SRR8316902	Silver flowering stage	0.226
	SRR8316904	Silver flowering stage	0.000
	SRR8316905	Silver flowering stage	0.116
	SRR8316906	Gold flowering stage	0.273
	SRR8316907	Gold flowering stage	0.000
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	0.000
	SRR6706287	Light intensity 50%	0.000
	SRR6706288	Light intensity 20%	0.000
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	0.000
	CNS0095593	Slightly white alabastrum(diploid) 2	0.198
	CNS0095594	Slightly white alabastrum(diploid) 3	0.004
	CNS0095595	Whole white alabastrum(diploid) 2	0.000
	CNS0095596	Whole white alabastrum(diploid) 3	0.491
	CNS0095597	Whole white alabastrum(diploid) 4	0.090
	CNS0095598	Silvery flower (diploied) 1	0.000
	CNS0095599	Silvery flower (diploied) 2	0.000
	CNS0095600	Silvery flower (diploied) 3	0.000
	CNS0095601	Golden flower (diploid) 1	0.243
	CNS0095602	Golden flower (diploid) 2	0.394
	CNS0095603	Golden flower (diploid) 3	0.221
	CNS0095604	Slightly white alabastrum(tetraploid) 1	0.000
	CNS0095605	Slightly white alabastrum(tetraploid) 2	0.000
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.000
	CNS0095607	Whole white alabastrum(tetraploid) 1	0.020
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.000
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.000
	CNS0095611	Silvery flower (tetraploid) 2	0.000
	CNS0095612	Silvery flower (tetraploid) 3	0.000
	CNS0095613	Golden flower (tetraploid) 1	0.045
	CNS0095614	Golden flower (tetraploid) 2	0.000
	CNS0095615	Golden flower (tetraploid) 3	0.000
CRA001975	CRR073297	Stem 1	0.201
	CRR073298	Stem 2	0.000
	CRR073299	Stem 3	0.000
	CRR073300	Leaf 1	0.000
	CRR073301	Leaf 2	0.000
	CRR073302	Leaf 3	0.000
	CRR073303	Juvenile bud 1	0.000
	CRR073304	Juvenile bud 2	0.000
	CRR073305	Juvenile bud 3	0.085
	CRR073306	Third green 1	0.019
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.000
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.149
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.000
	CRR073317	Gold flowering 3	0.000
	CRR073318	Tawny withering 1	0.092
	CRR073319	Tawny withering 2	0.528
	CRR073320	Tawny withering 3	0.000