Gene detail

Detail information of GWHGAAZE022786

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AGL39683.1	1.6444E-133	NAC transcription factor 027 [Jatropha curcas]
Swissprot	tr\|O49255\|NAC29_ARATH	6E-109	NAC transcription factor 29
trEMBL	tr\|R4N7L5\|R4N7L5_JATCU	6E-134	Uncharacterized protein {ECO:0000313\|EMBL:KDP41227.1}
TAIR10	AT1G69490.1	8E-88	NAC-like, activated by AP3/PI

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	78570135	78571178	+
GWHAAZE00000006	mRNA	78570135	78571178	+
GWHAAZE00000006	exon	78570135	78570300	+
GWHAAZE00000006	exon	78570416	78570696	+
GWHAAZE00000006	exon	78570816	78571178	+
GWHAAZE00000006	CDS	78570135	78570300	+
GWHAAZE00000006	CDS	78570416	78570696	+
GWHAAZE00000006	CDS	78570816	78571178	+

Transcript Sequence
>GWHTAAZE022816 ATGATAAGAAAAAACCCCTCTAATCTTCCTCCTGGATTTAGGTTCCACCCGACTGACGAGGAATTAATTATGTATTACCTTCAAAACCAGGCCACATCGCGTCCGTGTCCCGTCTCCATTATCCCAGAAGTCAATATCTATAAATTTGATCCTTGGGAGCTACCTGAAAAGGCCGAATTCGGAGAAAATGAATGGTATTTCTTTAGCCCCCGTGACCGAAAGTATCCTAACGGGGTCCGGCCCAATAGAGCTGCCGTCTCAGGTTATTGGAAGGCCACGGGAACCGATAAGGCCATCTATAGTGGATCCAAATATGTCGGTGTGAAGAAAGCTCTCGTGTTTTATAAGGGTAAGCCACCAAAGGGTATTAAGACTGACTGGATCATGCACGAATATCGCTTAAGTGAGTCACGAATACTACCCAACAAGAAAAGCGGATCAATGAGGTTGGATGATTGGGTCCTATGTAGGATTTATAAGAAGAAAAGTACAGGAAGAATTTTGGAGCCGAAAATGGAAGATTTGAGTGCCCAAACTTCCTCTGCAGAACATGAAGCTAATGACATACAATCTATGAAATTTCCGAGGACTTTTTCGATTTCTAATTTATGGGATTTAGAATACTTGGGCTCGATTTCACAACTTCTAAGTGATAATTCAAATTATGACAACCAAAACTCGATGTCAAGTTCTGGCGGGGTGCAATTTCCATCCCGGAATGTTCAGTTAGGGGAAATGTTGAACCCAAATGTGGATTCGGTGAAATTTCAAGTGAATCAAAATACCATGTTAAGCAGCCAATTCTTGTGA

Network for GWHGAAZE022786

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF02365.16	NAM	10	134	3.50E-39

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	NAC

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0003677	molecular_function	DNA binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	4.046
	SRR3591706	second leaf	0.000
	SRR3591707	mature leaf	2.781
	SRR3591708	Shoot apex	1.652
	SRR3591709	Stem	6.479
	SRR3591710	White floral bud	12.481
	SRR3591711	White flower	75.130
	SRR3591712	Green floral bud	1.792
	SRR3591713	Yellow flower	215.728
SRP173429	SRR8316895	Juvenile bud stage	0.872
	SRR8316896	Juvenile bud stage	5.022
	SRR8316897	Juvenile bud stage	3.171
	SRR8316894	Third green stage	1.345
	SRR8316900	Third green stage	4.161
	SRR8316901	Third green stage	4.576
	SRR8316898	Complete white stage	14.639
	SRR8316899	Complete white stage	10.370
	SRR8316903	Complete white stage	28.136
	SRR8316902	Silver flowering stage	32.470
	SRR8316904	Silver flowering stage	57.820
	SRR8316905	Silver flowering stage	34.385
	SRR8316906	Gold flowering stage	163.062
	SRR8316907	Gold flowering stage	151.473
	SRR8316908	Gold flowering stage	148.491
SRP132670	SRR6706286	Control	9.095
	SRR6706287	Light intensity 50%	5.862
	SRR6706288	Light intensity 20%	4.378
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	19.078
	CNS0095593	Slightly white alabastrum(diploid) 2	7.344
	CNS0095594	Slightly white alabastrum(diploid) 3	15.141
	CNS0095595	Whole white alabastrum(diploid) 2	9.305
	CNS0095596	Whole white alabastrum(diploid) 3	9.493
	CNS0095597	Whole white alabastrum(diploid) 4	11.038
	CNS0095598	Silvery flower (diploied) 1	32.394
	CNS0095599	Silvery flower (diploied) 2	46.996
	CNS0095600	Silvery flower (diploied) 3	110.652
	CNS0095601	Golden flower (diploid) 1	65.737
	CNS0095602	Golden flower (diploid) 2	135.349
	CNS0095603	Golden flower (diploid) 3	136.512
	CNS0095604	Slightly white alabastrum(tetraploid) 1	9.573
	CNS0095605	Slightly white alabastrum(tetraploid) 2	13.984
	CNS0095606	Slightly white alabastrum(tetraploid) 3	0.046
	CNS0095607	Whole white alabastrum(tetraploid) 1	10.678
	CNS0095608	Whole white alabastrum(tetraploid) 2	7.954
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.349
	CNS0095610	Silvery flower (tetraploid) 1	130.948
	CNS0095611	Silvery flower (tetraploid) 2	111.895
	CNS0095612	Silvery flower (tetraploid) 3	74.386
	CNS0095613	Golden flower (tetraploid) 1	239.738
	CNS0095614	Golden flower (tetraploid) 2	178.908
	CNS0095615	Golden flower (tetraploid) 3	416.283
CRA001975	CRR073297	Stem 1	2.271
	CRR073298	Stem 2	1.864
	CRR073299	Stem 3	2.125
	CRR073300	Leaf 1	1.383
	CRR073301	Leaf 2	1.671
	CRR073302	Leaf 3	0.409
	CRR073303	Juvenile bud 1	1.583
	CRR073304	Juvenile bud 2	4.341
	CRR073305	Juvenile bud 3	1.074
	CRR073306	Third green 1	21.282
	CRR073307	Third green 2	11.010
	CRR073308	Third green 3	15.335
	CRR073309	Second white 1	29.783
	CRR073310	Second white 2	39.251
	CRR073311	Second white 3	37.477
	CRR073312	Silver flowering 1	53.411
	CRR073313	Silver flowering 2	28.340
	CRR073314	Silver flowering 3	39.447
	CRR073315	Gold flowering 1	0.000
	CRR073316	Gold flowering 2	0.419
	CRR073317	Gold flowering 3	0.299
	CRR073318	Tawny withering 1	15.969
	CRR073319	Tawny withering 2	13.040
	CRR073320	Tawny withering 3	2.846