Gene detail

Detail information of GWHGAAZE022723

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	AAT07447.1	4.99028E-90	AP1-like protein [Vitis vinifera]
Swissprot	tr\|P0DI14\|AP1_BRARP	4E-77	Floral homeotic protein APETALA 1
trEMBL	tr\|Q6E6S7\|Q6E6S7_VITVI	2E-90	AP1-like protein {ECO:0000313\|EMBL:AAT07447.1}
TAIR10	AT1G69120.1	8E-49	K-box region and MADS-box transcription factor family protein

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	77552259	77553489	-
GWHAAZE00000006	mRNA	77552259	77553489	-
GWHAAZE00000006	exon	77552259	77552361	-
GWHAAZE00000006	exon	77552485	77552597	-
GWHAAZE00000006	exon	77552730	77552771	-
GWHAAZE00000006	exon	77552898	77552939	-
GWHAAZE00000006	exon	77553038	77553137	-
GWHAAZE00000006	exon	77553241	77553305	-
GWHAAZE00000006	exon	77553412	77553489	-
GWHAAZE00000006	CDS	77553412	77553489	-
GWHAAZE00000006	CDS	77553241	77553305	-
GWHAAZE00000006	CDS	77553038	77553137	-
GWHAAZE00000006	CDS	77552898	77552939	-
GWHAAZE00000006	CDS	77552730	77552771	-
GWHAAZE00000006	CDS	77552485	77552597	-
GWHAAZE00000006	CDS	77552259	77552361	-

Transcript Sequence
>GWHTAAZE022753 ATGGAGAAGATCCTTGAGCGGTATGAAAGATACTCTTACACCGAGAGACAGCTAGTTTCTCATGATCCACAATCTTCGGGAAACGTTACCCTTGAATACAACAAACTTAAGGCTAGGGTCGAGCTTTTACAAAGAAACTATAGGCACTATATAGGAGAAGATCTAGACGCCTTGAGCCTAAAAGACCTCCAAAATTTGGAGCAACAGCTTGATACTGCTCTTAAGCACATACGATCCCGTAAAAACCAACTCATGTATGACTCCATCTCCGAGCTTCAGAGAAAGGAAAGAGCAATTCAGGAGCAAAACAGCGCGCTATCGAAGAAGATTAAAGAGAAGGAAAAGACAATGGCGGAGCAAGCTTACTGGGATCAGCAAAACCATGCCCCAAATTCACCATCATTCCTCTTGCCTCAGCCGCTCCCCTTTCTTAACATCGGCACCGGCGCTTACCAGGGAGAAGCACTTGAAGAGAGGAGGAATGTTCTTGACCTCACTCTTGAACCGCTATTTTCGTGCCACCTCGGCTGCTTTGCCGAGTGA

Network for GWHGAAZE022723

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF01486.18	K-box	26	110	8.30E-29

Protein Sequence

Gene family

Gene family	subfamily
--	--

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0006355	biological_process	regulation of transcription, DNA-templated
GO:0005634	cellular_component	nucleus
GO:0003700	molecular_function	DNA-binding transcription factor activity

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	2.043
	SRR3591706	second leaf	0.191
	SRR3591707	mature leaf	0.398
	SRR3591708	Shoot apex	1.013
	SRR3591709	Stem	3.299
	SRR3591710	White floral bud	23.721
	SRR3591711	White flower	28.065
	SRR3591712	Green floral bud	5.359
	SRR3591713	Yellow flower	3.236
SRP173429	SRR8316895	Juvenile bud stage	5.060
	SRR8316896	Juvenile bud stage	1.255
	SRR8316897	Juvenile bud stage	0.147
	SRR8316894	Third green stage	1.866
	SRR8316900	Third green stage	0.700
	SRR8316901	Third green stage	0.509
	SRR8316898	Complete white stage	0.181
	SRR8316899	Complete white stage	5.418
	SRR8316903	Complete white stage	1.824
	SRR8316902	Silver flowering stage	0.000
	SRR8316904	Silver flowering stage	0.095
	SRR8316905	Silver flowering stage	0.000
	SRR8316906	Gold flowering stage	0.000
	SRR8316907	Gold flowering stage	0.083
	SRR8316908	Gold flowering stage	0.000
SRP132670	SRR6706286	Control	4.107
	SRR6706287	Light intensity 50%	3.555
	SRR6706288	Light intensity 20%	3.606
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.356
	CNS0095593	Slightly white alabastrum(diploid) 2	7.074
	CNS0095594	Slightly white alabastrum(diploid) 3	4.065
	CNS0095595	Whole white alabastrum(diploid) 2	13.256
	CNS0095596	Whole white alabastrum(diploid) 3	0.070
	CNS0095597	Whole white alabastrum(diploid) 4	6.230
	CNS0095598	Silvery flower (diploied) 1	31.069
	CNS0095599	Silvery flower (diploied) 2	26.263
	CNS0095600	Silvery flower (diploied) 3	4.690
	CNS0095601	Golden flower (diploid) 1	41.137
	CNS0095602	Golden flower (diploid) 2	21.950
	CNS0095603	Golden flower (diploid) 3	17.968
	CNS0095604	Slightly white alabastrum(tetraploid) 1	4.617
	CNS0095605	Slightly white alabastrum(tetraploid) 2	4.262
	CNS0095606	Slightly white alabastrum(tetraploid) 3	10.340
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.868
	CNS0095608	Whole white alabastrum(tetraploid) 2	0.442
	CNS0095609	Whole white alabastrum(tetraploid) 3	0.000
	CNS0095610	Silvery flower (tetraploid) 1	0.228
	CNS0095611	Silvery flower (tetraploid) 2	8.913
	CNS0095612	Silvery flower (tetraploid) 3	0.886
	CNS0095613	Golden flower (tetraploid) 1	1.163
	CNS0095614	Golden flower (tetraploid) 2	1.331
	CNS0095615	Golden flower (tetraploid) 3	0.316
CRA001975	CRR073297	Stem 1	1.231
	CRR073298	Stem 2	2.244
	CRR073299	Stem 3	1.083
	CRR073300	Leaf 1	1.716
	CRR073301	Leaf 2	3.367
	CRR073302	Leaf 3	0.354
	CRR073303	Juvenile bud 1	2.535
	CRR073304	Juvenile bud 2	1.127
	CRR073305	Juvenile bud 3	4.628
	CRR073306	Third green 1	0.000
	CRR073307	Third green 2	0.000
	CRR073308	Third green 3	0.648
	CRR073309	Second white 1	0.000
	CRR073310	Second white 2	0.000
	CRR073311	Second white 3	0.000
	CRR073312	Silver flowering 1	0.000
	CRR073313	Silver flowering 2	0.000
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	0.985
	CRR073316	Gold flowering 2	0.370
	CRR073317	Gold flowering 3	1.438
	CRR073318	Tawny withering 1	2.326
	CRR073319	Tawny withering 2	2.738
	CRR073320	Tawny withering 3	2.770