Gene detail

Detail information of GWHGAAZE022467

Functional Annotation

Database	Orthologs	E value	Annotation
Nr	CDP05465.1	5.3504E-109	unnamed protein product [Coffea canephora]
Swissprot	tr\|Q9C9X7\|IDD14_ARATH	1E-98	Protein indeterminate-domain 14 {ECO:0000303\|PubMed:16784536}
trEMBL	tr\|A0A068UA81\|A0A068UA81_COFCA	2E-109	Coffea canephora DH200=94 genomic scaffold, scaffold_16 {ECO:0000313\|EMBL:CDP05465.1}
TAIR10	AT1G68130.1	1E-80	indeterminate(ID)-domain 14

Location And Transcript Sequence (JBrowse)

Scaffold	Type	Start	End	Strand
GWHAAZE00000006	gene	73061536	73062217	-
GWHAAZE00000006	mRNA	73061536	73062217	-
GWHAAZE00000006	exon	73062103	73062217	-
GWHAAZE00000006	exon	73061536	73061978	-
GWHAAZE00000006	CDS	73062103	73062217	-
GWHAAZE00000006	CDS	73061536	73061978	-

Transcript Sequence
>GWHTAAZE022497 ATGTTTGATAATACTACCTCAACTGGACCTTCTTCCTCATCTGATGCCTTCACTTCCTCAGAAAATGGAACCACCAACAACAGCAAAAGAAAAAGAAGGCCAGCCGGTACGCCAGATGCGGAAGTGGTATCGCTTTCGCCCAAGACGCTACTGGAATCGGATAGGTACGTGTGCGAGATCTGTAACCAAGGGTTTCAGAGGGACCAGAATTTGCAGATGCACCGGAGGAGGCACAAGGTACCTTGGAAGTTGCTGAAGAGGGAGTCGCCGGAGGTGAGGAAGAGGGTGTTTGTTTGCCCAGAGCCGAGCTGCTTGCACCATAACCCTTGCCATGCCCTCGGCGATCTTGTGGGGATTAAGAAGCACTTCAAGAGGAAACACAGCAATAACAAGCAGTGGGTTTGTCAAAAGTGCTCTAAAGGATATGCTGTTCAATCAGATTACAAGGCTCATCTCAAAACTTGTGGCACCAGAGGCCATTCTTGCGACTGTGGTCGTGTTTTTTCAAGGTCTCTAAAATTTTCTCTCCAGCTAGCTACATTCTTCATCTTCTATTGA

Network for GWHGAAZE022467

Network category	Network	Top300 PCC genelist
Coexpression Positive	Network	Top300 PCC genelist
Coexpression Negative	Network	Top300 PCC genelist

Functional Module

Module ID	Function Annotation

Protein Structure

Pfam accession	Pfam name	Alignment start	Alignment end	E-value
PF00096.27	zf-C2H2	56	78	0.0013

Protein Sequence

Gene family

Gene family	subfamily
Transcription Factors Family	C2H2

KEGG pathway

KO	Enzyme	pathway	mapID
--	--	--	--

Gene Ontology

GO term	Ontology	Name
GO:0003676	molecular_function	nucleic acid binding

Expression pattern

Expression pattern detail

SRP	Sample	Description	TPM
SRP075780	SRR3591705	youngest leaf	25.499
	SRR3591706	second leaf	4.984
	SRR3591707	mature leaf	3.563
	SRR3591708	Shoot apex	18.062
	SRR3591709	Stem	33.054
	SRR3591710	White floral bud	18.216
	SRR3591711	White flower	18.322
	SRR3591712	Green floral bud	11.471
	SRR3591713	Yellow flower	3.556
SRP173429	SRR8316895	Juvenile bud stage	3.965
	SRR8316896	Juvenile bud stage	2.343
	SRR8316897	Juvenile bud stage	0.727
	SRR8316894	Third green stage	3.161
	SRR8316900	Third green stage	7.391
	SRR8316901	Third green stage	5.175
	SRR8316898	Complete white stage	4.097
	SRR8316899	Complete white stage	15.979
	SRR8316903	Complete white stage	8.241
	SRR8316902	Silver flowering stage	1.381
	SRR8316904	Silver flowering stage	1.477
	SRR8316905	Silver flowering stage	0.691
	SRR8316906	Gold flowering stage	2.104
	SRR8316907	Gold flowering stage	1.044
	SRR8316908	Gold flowering stage	1.824
SRP132670	SRR6706286	Control	12.994
	SRR6706287	Light intensity 50%	12.638
	SRR6706288	Light intensity 20%	13.288
CNP0000432	CNS0095592	Slightly white alabastrum(diploid) 1	3.797
	CNS0095593	Slightly white alabastrum(diploid) 2	5.542
	CNS0095594	Slightly white alabastrum(diploid) 3	2.959
	CNS0095595	Whole white alabastrum(diploid) 2	6.536
	CNS0095596	Whole white alabastrum(diploid) 3	4.202
	CNS0095597	Whole white alabastrum(diploid) 4	5.961
	CNS0095598	Silvery flower (diploied) 1	23.371
	CNS0095599	Silvery flower (diploied) 2	9.523
	CNS0095600	Silvery flower (diploied) 3	5.035
	CNS0095601	Golden flower (diploid) 1	7.539
	CNS0095602	Golden flower (diploid) 2	7.169
	CNS0095603	Golden flower (diploid) 3	8.303
	CNS0095604	Slightly white alabastrum(tetraploid) 1	10.027
	CNS0095605	Slightly white alabastrum(tetraploid) 2	7.330
	CNS0095606	Slightly white alabastrum(tetraploid) 3	24.297
	CNS0095607	Whole white alabastrum(tetraploid) 1	7.961
	CNS0095608	Whole white alabastrum(tetraploid) 2	3.449
	CNS0095609	Whole white alabastrum(tetraploid) 3	4.899
	CNS0095610	Silvery flower (tetraploid) 1	3.732
	CNS0095611	Silvery flower (tetraploid) 2	7.712
	CNS0095612	Silvery flower (tetraploid) 3	3.444
	CNS0095613	Golden flower (tetraploid) 1	2.444
	CNS0095614	Golden flower (tetraploid) 2	2.421
	CNS0095615	Golden flower (tetraploid) 3	1.470
CRA001975	CRR073297	Stem 1	17.204
	CRR073298	Stem 2	18.057
	CRR073299	Stem 3	15.600
	CRR073300	Leaf 1	15.137
	CRR073301	Leaf 2	18.419
	CRR073302	Leaf 3	14.606
	CRR073303	Juvenile bud 1	17.412
	CRR073304	Juvenile bud 2	9.593
	CRR073305	Juvenile bud 3	19.408
	CRR073306	Third green 1	2.331
	CRR073307	Third green 2	4.946
	CRR073308	Third green 3	8.620
	CRR073309	Second white 1	1.207
	CRR073310	Second white 2	1.003
	CRR073311	Second white 3	0.365
	CRR073312	Silver flowering 1	0.307
	CRR073313	Silver flowering 2	0.893
	CRR073314	Silver flowering 3	0.000
	CRR073315	Gold flowering 1	1.120
	CRR073316	Gold flowering 2	5.108
	CRR073317	Gold flowering 3	2.579
	CRR073318	Tawny withering 1	6.272
	CRR073319	Tawny withering 2	4.097
	CRR073320	Tawny withering 3	6.343